Promotorjeva hipermetilacija in zmanjšana ekspresija rassf1a sta pogosti molekularni spremembi endometrijskega karcinoma | sodobna patologija

Promotorjeva hipermetilacija in zmanjšana ekspresija rassf1a sta pogosti molekularni spremembi endometrijskega karcinoma | sodobna patologija

Anonim

Izvleček

Pri karcinomu endometrija so pogoste spremembe v regulaciji poti RAS – MAPK. RASSF1A je gen, ki zavira tumor, ki lahko to pot negativno uravnava. Ugotovljeno je bilo, da RASSF1A inaktivira promocijsko metilacijo v nekaterih humanih tumorjih. Namen študije je bil oceniti imunohistokemično izražanje RASSF1A v normalnem endometriju in karcinomu endometrija ter povezati njegovo izražanje z mutacijami K - RAS , prisotnostjo mikrosatelitske nestabilnosti, metiliranjem promotorja RASSF1A in klinikopatološkimi podatki. Imuno obarvanje RASSF1A je bilo ovrednoteno v enem tkivu, ki je bil zgrajen iz 80 vzorcev normalnega endometrija, vgrajenih v parafin, in dveh tkivnih mikroraščin, izdelanih s skupno 157 karcinomom endometrija (en zgrajen s 95 karcinomom endometrija, ki so bili predhodno ovrednoteni za mutacije K-RAS in mikrosatelitsko nestabilnost, in drugega, ki vsebuje 62 karcinomov endometrija, ki so bili prav tako podvrženi analizi metilacije promotorja RASSF1A ). Imuno obarvanje RASSF1A je bilo povezano s proliferacijo celic (Ki67), izražanjem Cyclin D1 in kliničnimi patološkimi podatki. Promotorsko metilacijo RASSF1A smo ocenili z metilacijsko specifičnim PCR. Imuno obarvanje RASSF1A je bilo med menstrualnim ciklom v normalnem endometriju spremenljivo. Ekspresija RASSF1A se je znatno zmanjšala pri 48% karcinomov endometrija, zlasti pri tumorjih, ki kažejo mikrosatelitsko nestabilnost. Metilacija RASSF1A -propersora je bila pri karcinomu endometrija (74%) zelo pogosta in je bila pogosto povezana z zmanjšano izražanjem RASSF1A. Hipermetilacija RASSF1A -propersora je bila pogosta pri karcinomu napredovalega endometrija. Rezultati kažejo, da lahko zmanjšana ekspresija RASSF1A igra vlogo pri karcinogenezi endometrija z nadzorom celične proliferacije in apoptoze po signalni poti MAPK.

Glavno

Karcinom endometrija lahko razvrstimo v dve glavni vrsti; 1 tip I so endometrioidni adenokarcinomi. 2 Običajno se razvijejo pri ženskah v perimenopavzi in so povezane z stimulacijo estrogena. Endometrioidni adenokarcinom lahko kaže mikrosatelitsko nestabilnost 3 in mutacije genov PTEN , 4 PIK3CA , 5 K-RAS 6 in β- katenina. 7, 8 Tumorji tipa II so ne-endometrioidni karcinomi, ki se ponavadi pojavljajo pri starejših ženskah, niso povezani s stimulacijo estrogena in so pogosto povezani z mutacijami p53 in kromosomsko nestabilnostjo. 9

Signalna pot RAS ima pomembno vlogo pri tumorigenezi. Mutacije v onkogenu RAS so odkrili pri številnih različnih vrstah tumorjev. Superdružina RAS majhnih beljakovin, ki vežejo GTP, ima temeljno vlogo pri celični rasti in diferenciaciji, regulaciji transkripcije in apoptozi. Pogostost mutacij K-RAS pri karcinomu endometrija se giblje med 10 in 30%. 6 V nekaterih serijah so poročali, da so mutacije K-RAS pogostejše pri endometrioidnem adenokarcinomu, ki kaže mikrosatelitsko nestabilnost. 6 V teh tumorjih so mutacije K-RAS običajno prehodi, pred katerimi je mogoče nenormalno metilacijo DNA. Dejstvo, da pri endometrioidnem adenokarcinomu mikrosatelitska nestabilnost pogosto obstaja s prehodi, ki so povezani z metilacijo K-RAS, vodi do domneve, da sta ti dve spremembi tesno povezani.

Pred kratkim je bil gen RASSF1A identificiran in preslikan na kromosom 3p.21.3. RASSF1A je najdaljša izoforma RASSF1, nove skupine efektorjev RAS, ki naj bi uravnavala proliferacijo celic in apoptozo. 10 Zaznano je bilo izražanje RASSF1A v katerem koli običajnem preskušanju tkiva. Vendar pa je bilo ugotovljeno, da so transkripti RASSF1A izgubljeni v več linijah rakavih celic. Prav tako ponovna ekspresija RASSF1A močno zmanjša celično rast tumorskih celic, ki podpira vlogo RASSF1A kot gena, ki zavira tumorje. Gen RASSF1A je epigenetično inaktiviran v velikem odstotku različnih človeških malignomov, vključno z raki pljuč, dojk, ledvic, mehurja, želodca, jajčnikov in nevroblastoma. 11

RASSF1A se lahko povezuje z onkogenim / mutantnim K-RAS ali z GTP-vezanim K-RAS s heterodimerizacijo z NORE1, proteinom, ki veže RAS-GTP. 12 Ta predpostavka postavlja hipotezo o genih K-RAS-BRAF-RASSF1A kot partnerjih na isti poti.

Metilacija promotorjev je pogost mehanizem inaktivacije genov endometrioidnega adenokarcinoma. Vključuje lahko veliko različnih genov, ki sodelujejo pri celični signalizaciji, apoptozi in celični proliferaciji ( p14 , PTEN , p16 , TSP-1 , IGF-2 , estrogenski receptor- α , HIC-1 , MLH-1 ). Neaktivacija hMHL-1 s promotorsko hipermetilacijo je prisotna pri večini endometrioidnih adenokarcinomov z mikrosatelitsko nestabilnostjo, kar kaže na to, da je nenormalna metilacija prvi korak pri pridobivanju mutatornega fenotipa v karcinogenezi endometrija. 13 Ker je spremenjen metilacijski status pogost pri endometrioidnem adenokarcinomu z mikrosatelitsko nestabilnostjo in pogosto soobstaja tudi mutacijam K-RAS , lahko domnevamo, da bi bila hipermetilacija promotorja RASSF1A lahko pogosta pri karcinomu endometrija, ki morda obstaja ob katerem koli od teh pojavov.

Glavni cilj te študije je bil oceniti pogostost zmanjšane ekspresije RASSF1A in RASSF1A -propertorske hipermetilacije v karcinomu endometrija v povezavi s prisotnostjo mikrosatelitske nestabilnosti, mutacijami K-RAS in kliničnopatološkimi podatki. Prav tako je bil namen te študije oceniti imunohistokemijsko izražanje RASSF1A v normalnem endometriju, v različnih fazah menstrualnega cikla, z uporabo tehnologije mikroarray .

Materiali in metode

Tkivne mikroraščice

Izdelane so bile tri tkivne mikroarte. Prva tkivna mikroarketa je bila zgrajena iz 80 vzorcev normalnega endometrija, vgrajenih v parafin, v različnih fazah menstrualnega cikla, pridobljenih iz kirurških patoloških datotek bolnišnice Universitari Arnau de Vilanova de Lleida. Drugo tkivno mikroreznico je sestavljalo 95 karcinomov endometrija, ki so bili predhodno ovrednoteni za mutacije K-RAS in mikrosatelitsko nestabilnost. 3, 6 Tretja mikroceličina tkiva je bila zgrajena iz 62 karcinomov endometrija, ki so bili tudi podvrženi metilaciji RASSF1A -propultera (glej spodaj). V zadnjih dveh mikrorastih tkiva je bilo vključenih 157 karcinomov endometrija, pridobljenih iz kirurških patoloških spisov Hospital Universitari Arnau de Vilanova de Lleida in Hospital de Sant Pau, Barcelona, ​​Španija. Vključevali so 47 endometrioidnih adenokarcinomov 1. stopnje, 58 endometrioidnih adenokarcinomov stopnje II, 26 endometrioidnih adenokarcinomov III razreda, 15 seroznih karcinomov, štiri jasnocelične karcinome in sedem mešanih mullerskih malignih tumorjev. Osemnajst tumorjev je bil I-stopnja, 15-stopnja-II karcinom, 22 stadija-III in en karcinom stopnje IV. Podatki o postopkih so bili za 11 primerov nepopolni. Študijo je odobril lokalni etični odbor. Od vseh oseb je bilo pridobljeno posebno informirano soglasje.

Za izdelavo mikroračunov tkiva smo uporabili napravo Tissue Arrayer (Beecher Instrument, MD, ZDA). Na kratko so bili vsi vzorci histološko pregledani, reprezentativna območja pa so bila označena v ustreznih parafinskih blokih. Vsak primer je bil izbran dva izbrana jeklenka (največji premer 0, 6 mm) iz dveh različnih področij. Vključeni so bili tudi normalni tkivi iz istih vzorcev karcinoma endometrija.

Imunohistokemijska študija

Tkivno-mikroarki smo odsekali pri debelini 3 μm , posušili 16 ur pri 56 °, preden smo jih razmaščevali v ksilenu in rehidrirali z nizom stopnjevanih koncentracij etanola, nato pa jih sprali s fiziološko raztopino, puferirano s fosfatom. Nabavo antigena smo dosegli s toplotno obdelavo v kuhalniku 2 minuti v EDTA (pH 8, 9). Pred obarvanjem odsekov je bila aktivnost endogene peroksidaze blokirana. Uporabljena protitelesa so bila naslednja: anti-RASSF1A (1: 500 razredčitev; eB114-20H1; eBioscience), Ki67 (razredčenje 1: 100; MIB-1; Dako) in ciklin D1 (redčenje 1:25; DCS6; Dako). Po inkubaciji smo reakcijo vizualizirali s kompletom za zaznavanje EnVision (Dako), pri čemer smo kot substrat uporabili diaminobenzidinski kromogen. Odseki so bili kontrastanirani s hematoksilinom. Testirali smo tudi ustrezne pozitivne in negativne kontrole.

Dva imunohistokemična rezultata sta ocenjevala dva patologa po enotnih vnaprej določenih merilih. Imuno ekspresijo RASSF1A smo ocenili polkvantitativno glede na odstotek in intenzivnost obarvanja. Za vsak vzorec smo dobili histološko oceno, ki je znašala od 0 (brez imunoreakcije) do 300 (največja imunoreaktivnost). Rezultat smo dobili z uporabo naslednje formule: Histoscore = 1 × (% lahkega obarvanja) +2 × (% zmerno obarvanje) +3 × (% močno obarvanje). Zanesljivost takega rezultata za interpretacijo imunohistokemičnega obarvanja v mikroračunih tkiva karcinoma endometrija je bila že dokazana. 14, 15, 16, 17 Ker je vsaka mikroarketa tkiva vključevala dva različna cilindra tumorja iz vsakega primera, je bilo po pregledu obeh vzorcev opravljeno imunohistokemijsko vrednotenje. Za konec smo uporabili odstotek pozitivnih jeder v vsakem primeru za oceno celične proliferacije (Ki67) in izražanja ciklin D1.

Ponovljivost imunsko obarvanja tkiva in mikroarrame je bila potrjena s primerjavo rezultatov tkivne mikrorase s tistimi, pridobljenimi na odsekih iz ustreznih parafinskih blokov 37 naključno izbranih primerov. Skupna skladnost je znašala 89, 2%. Kappa indeks soglasja med obema metodama se je gibal med 0, 68 in 0, 83.

PCR za specifično metilacijo

Genski DNK smo izolirali s kompletom DNAeasy tkiva (Qiagen GmbH, Hilden, Nemčija) iz normalnega in tumorskega tkiva pri 57 bolnikih z endometrijskim karcinomom. Vzorci so bili po operaciji zamrznjeni in ustrezajo 57 od 62 vzorcev karcinoma endometrija tretjega tkiva mikrosvetov. Uporabljeno je bilo posebno informirano soglasje, študijo pa je odobril lokalni etični odbor. DNA je bila podvržena zdravljenju z bisulfitom. Na kratko smo 1 μg DNK denaturirali z natrijevim hidroksidom in spremenili natrijev bisulfit. Nato smo vzorce DNK očistili in ponovno obdelali z natrijevim hidroksidom, oborili z etanolom in resuspendirali v vodi (EZ DNA metilacijski komplet; ZYMO RESEARCH, ZDA). Status metilacije RASSF1A -promotora je bil določen po protokolih iz prejšnjih študij. 18 DNK smo amplificirali s primerjema MF (GTGTTAACGCGTTGCGTATC) in MR (AACCCCGCGAACTGAAAAACGA) za metilirano DNK in UF (TTTGGTTGGAGTGTGTTAATGTG) in UR (CAAACCCCACAAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA). Vsaka reakcija PCR je vsebovala 1 × pufer, 1, 5 mM MgCl2 in 1 U / μl TaqGold (Applied Biosystems Inc., Santa Clara, CA, ZDA); 0, 2 mM dNTPs (Biotools B&M Labs, SA, Madrid, Španija) in 0, 2 μM vsakega temeljnega premaza. Pogoji PCR so bili naslednji: začetna 10-minutna denaturacija pri 96 ° C, ki ji sledita dva cikla po 30 s pri 95 ° C, 30 s pri 67 ° C, 30 s pri 72 ° C; dodatna dva cikla 30 s pri 95 ° C, 30 s pri 65 ° C, 30 s pri 72 ° C, nadaljnja dva cikla 30 s pri 95 ° C, 30 s pri 63 ° C, 30 s pri 72 ° C ciklov in končni korak podaljšanja 10 min pri 72 ° C. Vsak izdelek PCR smo neposredno naložili na 3% agarozni gel, obarvali z etidijevim bromidom in vizualizirali pod UV osvetlitvijo.

Statistična analiza

Statistična analiza je bila izvedena z bazo podatkov z uporabo SPSS za Windows (različica 11.5; SPSS Inc., Chicago, IL, ZDA). Imunohistokemijske rezultate so primerjali Mann – Whitney U in Studentov t-test, če je bilo to primerno. Povezave med kvalitativnimi spremenljivkami so bile ocenjene z χ 2 - ali Fisherjevim natančnim testom. Korelacije med kvantitativnimi spremenljivkami so bile ugotovljene s Pearsonovim in Spearmanovim ρ testom. Statistični pomen je bil določen pri P ≤ 0, 05.

Rezultati

Imunohistokemija

V normalnem endometriju je bil RASSF1A ovrednoten v vseh 80 primerih, ki so bili vključeni v prvo tkivno mikroarno. Imuno obarvanje RASSF1A se je spreminjalo glede na različne faze menstrualnega cikla. Imunoekspresija RASSF1A je bila v proliferativni fazi (povprečni histoskor, 45, 96) bistveno večja kot v sekretornem endometriju (povprečni histoskor, 31, 58) ( P = 0, 001) (slika 1). Obarvanje je bilo citoplazemsko. Stromalne celice so bile pozitivne tako v proliferativni kot v sekretorni fazi.

Image

Imuno obarvanje RASSF1A je bilo v proliferativni fazi ( a, b ) večje kot v sekretorni fazi ( c, d ).

Slika v polni velikosti

Pri karcinomu endometrija je bil RASSF1A ovrednoten v 148 od 157 primerov, ki so bili vključeni v drugo in tretjo tkivno mikroraščico. Šest primerov je bilo izključenih, ker ni bilo reprezentativnega tumorskega tkiva v odsekih tkivne mikroraseve, trije primeri pa so bili zamujeni pri gradnji tkivne mikrorase. Na splošno se je imunoekspresija RASSF1A pri karcinomu endometrija v primerjavi z običajnim endometrijem znatno zmanjšala. Povprečna vrednost histoskora RASSF1A je bila 27, 28 v karcinomu endometrija in 70, 00 v normalnem endometriju ( P = 0, 007). Opazili smo negativno obarvanje za RASSF1A v 71 primerih karcinoma endometrija (48%), medtem ko je bilo preostalih 77 primerov pozitivno (52%). Obarvanje je bilo citoplazemsko in heterogeno, histoskor pa od 10 do 290 (sliki 2 in 3). Jedrsko imunološko obarvanje so opazili v 11 primerih.

Image

Imuno ekspresija RASSF1A v karcinomu endometrija brez hipermetilacije RASSF1A -prosoterja . Opazite močno citoplazemsko obarvanje ( a, b ).

Slika v polni velikosti

Image

RASSF1A imuno obarvanje v karcinomu endometrija s hipermetilacijo RASSF1A -prosoter . Opazite, da je citoplazemska obarvanost ( a, b ) nižja kot v primeru, prikazanem na slikah 2a in b. Ustrezno normalno tkivo je pokazalo pozitivno obarvanje ( c ).

Slika v polni velikosti

Rahlo zmanjšano imunsko obarvanje RASSF1A smo opazili pri ne-endometrioidnem karcinomu endometrija (povprečni histoskor, 25, 25) v primerjavi z endometrioidnim karcinomom endometrija (povprečni histoskor, 30, 18). Vendar te razlike niso bile statistično pomembne ( P = 0, 457). Korelacija med imuno ekspresijo RASSF1A in histološko stopnjo ali patološko stopnjo ni dobila nobene pomembne razlike ( P = 0, 771 in P = 0, 303). Med celično proliferacijo (Ki67) in imuno ekspresijo RASSF1A ( r = 0, 088, P = 0, 446) ni bilo pomembne korelacije. Jedrsko izražanje ciklina D1 so opazili v 64, 79% primerov endometrijskega karcinoma, ni pa bilo ugotovljeno povezave z ekspresijo proteina RASSF1A ( P = 0, 635).

Končno je bila imunoekspresija RASSF1A povezana z nestabilnostjo mikrosatelitov in mutacijami K-RAS v 67 primerih endometrijskega karcinoma iz drugega tkiva. Kadar smo ocenili popolno odsotnost izraza RASSF1A (Histoscore 0), smo ugotovili kot negativno ( P = 0, 510 in P = 0, 294). Vendar pa se je povezava med imunsko obarvanostjo RASSF1A in prisotnostjo mikrosatelitske nestabilnosti izkazala za pomembno, ko smo kot negativni obravnavali karcinom endometrija z histocore manjšo od 50. Drugače povedano, 18 od 20 karcinomov endometrija z mikrosatelitsko nestabilnostjo je pokazalo, da histoskori znašajo manj kot 50 ( P = 0, 042) (tabela 1). Poleg tega je bilo sedem od desetih primerov z mutacijami K-RAS negativno na imunoekspresijo RASSF1A (Histoscore manj kot 50), vendar razlike niso bile statistično značilne ( P = 0, 540) (Tabela 1).

Tabela polne velikosti

RASSF1A -Promoter hipermetilacija

Hipermetilacija RASSF1A -prosoterja je bila odkrita pri 42 od 57 (74%) vzorcev karcinoma endometrija, ki so bili testirani (slika 4). V nekaterih primerih je bila stopnja metilacije promotorjev različna na različnih območjih tumorja (slika 4, primer 2, T1 in T2). Metilacija promotorja pri običajnih vzorcih tkiv pri istih bolnikih z endometrijskim karcinomom ni bila zaznana. Zanimivo je, da se je pogostost metilacije RASSF1A -prosoterja povečala v povezavi s patološko stopnjo (tabela 2). Metilacijo RASSF1A -prosoterja smo opazili pri 67% primerov karcinoma endometrija stadije IA ali stadija-IB (18/26) v primerjavi z 80% karcinomov endometrija v stopnji-IC (10/14) in 100% karcinomov endometrija III-faze IIIA (6/6). Velika večina nemetiliranih tumorjev RASSF1A je bila karcinom endometrija s stopnjo IA (54, 5%) (6/11), le dva od karcinomov endometrija 16 stadij II ali faza III pa sta bila metilirana (12%). Hipermetilacija RASSF1A -prosoter je bila pogostejša med endometrioidnimi karcinomi (75%) (37 od 49 primerov) v primerjavi z ne-endometrioidnimi karcinomi (62, 5%) (5 od 8 primerov), vendar te razlike niso bile statistično pomembne ( P = 0, 422) . RASSF1A so analizirali tudi v povezavi s histološko oceno. Karcinomi endometrija stopnje I in II stopnje so bili pogosteje metilirani (71 oziroma 86%) kot tumorji stopnje III (57%). Vendar razlike niso bile pomembne ( P = 0, 152).

Image

MS-PCR za gen RASSF1A v karcinomu endometrija in normalnem tkivu. U, PCR produkt s primerji, značilnimi za nemetilirano DNK; M, PCR produkt s primerji, specifičnimi za metilirano DNK. RASSF1A se metilira v treh primerih karcinoma endometrija. Opazite, da se je stopnja hipermetilacije promotorja razlikovala med dvema različnima območjema enega tumorja (T1 in T2) primera 2.

Slika v polni velikosti

Tabela polne velikosti

Korelacija med imunsko obarvanjem RASSF1A in hipermetilacijo RASSF1A -Promoter

Na koncu smo ocenili povezavo med imunoekspresijo RASSF1A in statusom metilacije gena za promotorje v 53 od 57 začetnih primerov, preučenih na hipermetilacijo RASSF1A -prosoterja . RASSF1A je metiliral v 26 od 27 primerov, ki so bili negativni na imunsko obarvanje RASSF1A (tabela 3). Kot smo pričakovali, je bila ekspresija beljakovin RASSF1A dramatično zmanjšana v primerih metilacije RASSF1A -propultera (povprečni histoskor, 30, 38) v primerjavi z nemetiliranimi primeri (povprečje: 101, 92), razlike pa so bile statistično značilne ( P = 0, 000). Vendar pa je bilo v 14 primerih ugotovljeno imunsko obarvanje RASSF1A v prisotnosti metilacije RASSF1A -propultera . Zanimivo je, da je bilo obarvanje RASSF1A v teh primerih heterogeno in šibkejše. Izvedena je bila primerjava med primeri s pozitivno ali negativno hipermetilacijo RASSF1A -prosoterja med karcinomom endometrija s pozitivnim obarvanjem RASSF1A. Zanimivo je, da so primeri endometrijskega karcinoma z metilacijo RASSF1A -prosoterja pokazali zmanjšano imunoekspresijo RASSF1A (povprečni histoscore, 86, 09) v primerjavi z nemetiliranimi primeri (srednji histoskop, 110, 42) (slika 5), ​​vendar te razlike niso bile pomembne ( P = 0, 274).

Tabela polne velikosti

Image

Primerjava okvirja na osnovi imunoekspresije in stanja metilacije RASSF1A.

Slika v polni velikosti

Diskusija

Epigenetska inaktivacija je opredeljena kot sprememba, naložena funkcionalnosti gena, ki ne vključuje spremembe njegovega kodirnega zaporedja. Transkripcijsko utišanje s hipermetilacijo otokov CpG v promotorskih regijah tumorskih supresorskih genov postaja pogost pojav v karcinogenezi. Čeprav je ta pojav opažen v širokem spektru tumorjev, je pogost mehanizem inaktivacije gena za supresorje tumorja pri karcinomu endometrija. De novo metilacija promotorja RASSF1A je eden najpogostejših dogodkov inaktivacije, odkrit pri človeškem raku in vodi v utišanje izražanja RASSF1A . 11 C-konec RASSF1A je homologen s sesalcem RAS-efektorskega proteina NORE1 in kodira RAS-asociacijsko domeno. Tri glavne variante spajkanja, RASSF1A, RASSF1B in RASSF1C, so prepisane z dveh različnih otokov CpG, ločenih približno 3, 5 kb. 19

V pričujoči študiji smo ocenili imunohistokemijsko izražanje in prisotnost promotorske hipermetilacije gena RASSF1A v karcinomu endometrija in odkrili zmanjšano izražanje RASSF1A v 48% primerov, promocijsko hipermetilacijo pa v 73%. Poleg tega je bila med obema pojavnima statistično pomembna povezava. Čeprav je bila hipermetilacija RASSF1A -prosoterja že predhodno ovrednotena pri karcinomu endometrija, je to prva študija v literaturi, ki dokazuje, da je povezana z zmanjšano izražanjem proteinov RASSF1A, v veliki seriji karcinoma endometrija in pristopom tkiva-mikroraščanja. V drugih raziskavah so poročali o pogostosti hipermetilacije RASSF1A -prosoterja v karcinomu endometrija med 30 in 85%, kar je bilo ugotovljeno z metilacijsko specifičnim PCR (MS-PCR). 20, 21 Poleg tega so v nedavni študiji Kang in sod. Ugotovili hipermetilacijo promotorja v dveh od štirih celičnih linij endometrijskega karcinoma, ki so bili testirani na hipermetilacijo promotorja ( AN3-CA , HEC-1-B , KLE , RL95-2 ). Dokazali so tudi, da celične linije endometrijskega karcinoma s hipermetilacijo promotorja, zdravljene s 5-aza-2-deoksicitidinom, zdravilom, ki zavira metilacijo DNA, obnovijo ekspresijo RASSF1A .

Ekspresija proteina RASSF1A je bila v naših vzorcih karcinoma endometrija heterogena. Nekateri primeri so bili na številnih področjih RASSF1A pozitivni, na nekaterih žariščih pa negativni, nekateri vzorci, negativni na RASSF1A, pa so vsebovali majhen delež celic, ki so se močno obarvali. Po našem mnenju je razlog za heterogeno porazdelitev hipermetilacije RASSF1A -prosoterja, ki pojasnjuje, zakaj smo v tumorjih s pozitivno imunoodločanjem za RASSF1A odkrili hipermetilacijo RASSF1A -prosoterja. Ta pojav lahko najdemo tudi pri drugih vrstah tumorjev in z drugimi geni, ki jih utiša s promotorsko metilacijo. Na primer, pred kratkim je bilo ugotovljeno, da se heterogena ekspresija proteinov nekaterih genov, vključno z RASSF1A , opazi v približno 70% primerov malignega melanoma zaradi intra-tumorske porazdelitve hipermetilacije v promotorju. 22

Med tumorigenezo je aktivirani RAS običajno povezan s povečano proliferacijo, transformacijo in preživetjem celic. Učinkovci RAS, kot RASSF1A, naj bi imeli zaviralni rastni signal, ki ga je treba med tumorigenezo inaktivirati. S pomočjo različnih vrst tumorjev smo dobili kontradiktorne rezultate med inaktivacijo RASSF1A in mutacijo K-RAS . Bila sta medsebojno izključujoča dogajanja pri raku debelega črevesa in trebušne slinavke, 23, 24, vendar pri pljučnem raku ta povezava ni bila pomembna. 25 Nazadnje, pri raku ščitnice se metilacija RASSF1A medsebojno izključuje z mutacijami v BRAF . 26 Ker so mutacije BRAF pri karcinomu endometrija zelo redke, smo se osredotočili na povezanost inaktivacije RASSF1A in mutacije K-RAS in nestabilnosti mikrosatelita.

V naši seriji endometrijskega karcinoma je bilo sedem od 10 primerov z mutacijami K-RAS negativno na imunoekspresijo RASSF1A. Kang in drugi so ugotovili, da je hipermetilacija RASSF1A zelo močno povezana z mikrosatelitsko nestabilnostjo in je obratno povezana z mutacijami K-RAS / BRAF pri karcinomih endometrija, negativnih na nestabilnost, na mikrosatelit. Nedavno so Pijnenborg in drugi poročali o hipermetilaciji RASSF1A pri 85% ponavljajočega se karcinoma endometrija, ne da bi ugotovili kakršno koli povezavo med statusom metilacije RASSF1A in mutacijo K-RAS ali BRAF . Zanimivo je, da so pokazali hipermetilacijo RASSF1A v vzorcih hiperplazij endometrija (50%), cikličnih (21%) in atrofičnega endometrija (38%). Avtorja predlagata vlogo metilacije RASSF1A kot zgodnjega dogodka v karcinogenezi endometrija. Vendar pa nismo uspeli odkriti hipermetilacije RASSF1A -promotera v nobenem od običajnih vzorcev tkiv, ki ustreza 57 primerom karcinoma endometrija. Poleg tega je bil vzorec obarvanja, ki smo ga dobili v normalnem tkivu endometrija, odvisen od faze menstrualnega cikla, ki kaže, da je v normalnem endometriju RASSF1A pod regulacijo steroidnih hormonskih signalnih poti.

Mikrosatelitska nestabilnost se pojavi pri 25–30% sporadičnega karcinoma endometrija in je značilna za endometrioidni adenokarcinom. Identifikacija metilacije otoka CpG v več genih v karcinomu debelega črevesa in želodca z mikrosatelitsko nestabilnostjo nakazuje povezavo med spremenjeno metilacijo in fenotipom mikrosatelitskega mutatorja. V tej študiji smo analizirali možno povezavo med izražanjem RASSF1A in statusom mikrosatelitske nestabilnosti v našem pristopu tkivo-mikroarrazija. Opazili smo statistično pomembno povezavo med zmanjšano ekspresijo beljakovin RASSF1A in mikrosatelitsko nestabilnostjo, ko smo šteli za negativne tiste tumorje, ki imajo histoskor RASSF1A manj kot 50. Naši rezultati podpirajo podatke Kanga in sodelavcev, ki so tudi pokazali, da je metilacija RASSF1A močno povezana z mikrosatelitska nestabilnost in metilacija hMLH-1 . Podobni rezultati so bili dobljeni tudi pri raku debelega črevesa in danke, pri katerem je bila v mikrosatelitski nestabilnosti + kolorektalni raki opisana večja pogostnost metilacije RASSF1A -promotra v primerjavi s tumorji brez fenotipa mikrosatelitske nestabilnosti. Rezultati kažejo, da se lahko metilacija, ki vpliva na promotor RASSF1A, zgodi v okviru mikrosatelitske nestabilnosti + endometrioidni adenokarcinom.

V pričujoči seriji smo opazili večjo pogostnost metilacije RASSF1A -prosotera v povezavi z napredno patološko stopnjo in slabo diferenciranimi karcinomi. V soglasju s tem rezultatom so Jo et al . 27 ugotovili, da je metilacija RASSF1A v karcinumu endometrija v povezavi z napredovalo fazo (III, IV), prizadetostjo bezgavk in visoko histološko stopnjo bistveno pogostejša. Poleg tega so pokazali večjo incidenco recidivov in nižje preživetje brez bolezni pri bolnikih s hipermetilacijo RASSF1A .

Nazadnje smo opazili jedrsko imunološko obarvanje RASSF1A v nekaterih primerih karcinoma endometrija. Biokemijske študije so pokazale, da je RASSF1A protein, ki veže mikrotubule, ki uravnava mitotično napredovanje. 28 Pokazalo se je tudi, da prekomerna ekspresija RASSF1A povzroči mitotični zastoj pri metafazi z abberrantnimi mitotičnimi celicami. 28 RASSF1A uravnava mitozo tako, da zavira kompleks, ki pospešuje anafazo, preko Cdc20, in sproži zastoj G2-M pri prometu. Prav tako RASSF1A preprečuje razgradnjo ciklina D1 in zavira mitotsko napredovanje. 29 RASSF1A lahko vpliva tudi na druge cikline, kot sta ciklin D3 ali ciklin A, s pomočjo interakcije s transkripcijskim faktorjem p120 E4F, ki povzroči zaustavitev celičnega cikla in zagotavlja mehanično povezavo z drugimi znanimi zaviralci tumorjev, kot so p14 ARF , Rb in p53, za katere je znano, da medsebojno vplivajo na p120 E4F . 30 Za oceno možnega razmerja med RASSF1A in stroji za celični cikel smo preverili razmerje med izražanjem RASSF1A z izrazom ciklin D1 ali indeksom širjenja (Ki67 obarvanje), vendar nismo ugotovili pomembne povezave.

Če povzamemo, prvič poročamo o zmanjšani ekspresiji beljakovin RASSF1A v karcinomu endometrija z uporabo tkivno-mikroarrijske tehnologije in zmanjšano imuno ekspresijo RASSF1A v primerih s promotorsko hipermetilacijo. Prav tako prikazujemo večjo pogostost metilacije RASSF1A -prosoterja v fazi napredovalega karcinoma endometrija, kar kaže, da bi lahko bil RASSF1A koristen pokazatelj agresivnosti tumorja pri bolnikih z endometrijskim karcinomom.

Konflikt interesov

Avtorja navajata, da ni navzkrižja interesov.