Il-17 povzroči sevalno odpornost celic b limfoma, tako da zavira izražanje p53 in s tem zavira apoptozo, ki jo sproži obsevanje | celična in molekularna imunologija

Il-17 povzroči sevalno odpornost celic b limfoma, tako da zavira izražanje p53 in s tem zavira apoptozo, ki jo sproži obsevanje | celična in molekularna imunologija

Anonim

Izvleček

p53 je dobro znan zaviralec tumorjev. Vendar pa regulativni mehanizmi za izražanje p53 v celicah B limfoma in možna vloga p53 pri razvoju radioresistence v tumorskih celicah v glavnem niso znani. Kot model radioodpornosti je bila uporabljena človeška celična linija limfoma B, Karpas1106 (k1106). Apoptoza k1106 celic je bila določena s pomočjo protočne citometrije. Ekspresija p53 je bila ocenjena z uporabo RT-PCR v realnem času in Western blottingom. Rezultati so pokazali, da je obsevanje pri 8 Gy povzročilo apoptozo do 40% k1106 celic. Obenem je obsevanje močno povečalo proizvodnjo IL-6 celic k1106. Ko so kultivirali k1106 celice z regulacijskimi T celicami (Tregs) in jih obsevali, se je hitrost apoptotičnih celic k1106 znatno zmanjšala, kar kaže na pridobljeno odpornost proti obsevanju. IL-6, pridobljen iz celic k1106, obdelanih z obsevanjem, je v Tregsu sprožil ekspresijo IL-17. Celice IL-17 + Foxp3 + T so potlačile izraz p53 v k1106 celicah. Kolektivno obsevane celice k1106 inducirajo ekspresijo IL-17 v Tregsu, kar moti ekspresijo p53 proteina v k1106 celicah in s tem zavira apoptozo, ki jo sproži obsevanje v k1106 celicah.

Uvod

Limfom je krvni rak, sestavljen iz T celic ali B celic. Tako T kot B celice so pomembne imunske celice v telesu. Delujejo za boj proti napadom mikrobov ali preprečevanje avtoimunskih bolezni. Iz neznanih razlogov nekateri limfociti preživijo življenjsko dobo, kar ima za posledico limfom. Limfom se lahko lokalizira na bezgavkah, krvi, vranici, kostnem mozgu ali drugih limfoidnih tkivih. Do danes je patogeneza limfoma nejasna. 1

Pri limfomu maligne celice običajno izvirajo iz povečanih bezgavk. Terapevtska sredstva za limfom vključujejo kemoterapijo, radioterapijo in presaditev kostnega mozga. 2, 3 Če se limfom večinoma lokalizira v bezgavkah, se lahko uporabi radioterapija. 4 Čeprav je odpornost proti radioterapiji dobro prepoznan pojav, 5 osnovni mehanizem ni popolnoma razumljen.

Radioresistenca omogoča, da organizmi živijo v okolju z visokimi stopnjami ionizirajočega sevanja. Radioresistenco lahko povzroči večkratna izpostavljenost majhnim odmerkom ionizirajočega sevanja; 6 slednji je pogost postopek pri zdravljenju raka z ionizirajočim sevanjem. 7 Tako je radioresistenca tudi pogost pojav pri bolnikih z rakom, ki prejemajo ionizirajoče sevanje. 8 Mehanizem radioresistence bomo nadalje preučili.

V zdravih razmerah ima telo regulativni sistem za odpravo sporadičnih rakavih celic. Eden od mehanizmov je izražanje proteina p53 v celicah. Protein p53 je znan kot tumorski supresor, ki deluje tako, da povzroči apoptozo tumorskih celic in smrt. Številna poročila so razkrila mutacijo ali supresijo p53 v tumorskih celicah, 9, 10 kar poudarja pomen ustrezne funkcije p53 pri imunskem nadzoru v telesu. Dejavniki, ki povzročajo nepravilnosti p53, so nejasni.

Interlevkin (IL) -17 je citokin, ki ga izločajo T-pomožne (Th) 17 celice. Regulativne T celice (Tregs) lahko proizvedejo IL-17 v danem mikrookolišču. 11 Objavljeni podatki kažejo, da je IL-17 povezan s patogenezo raka 11, 12 tako, da igra vlogo bodisi pri tumorigenezi bodisi v fazi izločanja imunoeditiranja raka 13 in z interakcijo s p53 v tumorskih celicah. 14 Na podlagi zgornjih informacij domnevamo, da IL-17 zavira izražanje p53 v limfomskih celicah, kar preprečuje apoptozo celic limfoma. V tej raziskavi smo opazili, da obsevanje povzroča izražanje IL-6 v celicah B limfoma; IL-6 je povzročil Treg ekspresijo IL-17, kar je zaviralo p53 ekspresijo in preprečilo apoptozo v limfomskih celicah.

Materiali in metode

Reagenti

Protitelesa proti IL-6 in p53 so bila pridobljena od Santa Cruz Biotech (Santa Cruz, Kalifornija, ZDA). IL-17 protein, nevtralizirajoča protitelesa proti IL-6 in IL-17, in ELISA kompleti za IL-6 in IL-17 so bili pridobljeni iz R&D Systems (Minneapolis, MN, ZDA). Protitelesa, označena s fluorohromom, Foxp3 in IL-17 so bila kupljena pri podjetju BD Bioscience (San Jose, CA, ZDA). RT-PCR reagenti v realnem času so bili dobljeni iz Invitrogen (Carlsbad, CA, ZDA).

Celična kultura

K1106 celična linija in BC-3 celična linija sta bila kupljena od ATCC (Peking, Kitajska) in gojena v mediju RPMI 1640, dopolnjenem z 10% fetalnim govejim serumom, 2 mM L- glutaminom, 0, 1 mg / ml streptomicina in 100 U / ml penicilin. Medij je bil spremenjen v vsakih 1-2 dneh.

Test celicne sposobnosti preživetja

Prožnost celic smo ocenili s testom izključitve modrega tipa Trypan. Pred uporabo pri poskusih je bila sposobnost preživetja celic večja od 98%.

Obsevanje

k1106 celice so gojili, kot je opisano zgoraj, in jih obdelali z obsevanjem z uporabo 8-MV linearnega linearnega pospeševalnika (Elekta Synergy Platform; ELEKTA Ltd, Stockholm, Švedska) s hitrostjo odmerka 255 cGy / min; skupni odmerek je bil 0–8 Gy. Kontrolne celice k1106 smo gojili samo z medijem. Šest ur po obsevanju so celice uporabili za nadaljnje poskuse.

Kvantitativni RT-PCR v realnem času (qRT-PCR)

Celice k1106 smo trikrat sprali s fiziološko raztopino, fosfatno pufrano. Z uporabo Trizolovih reagentov smo iz celic ekstrahirali celotno RNA. CDNA je bila sintetizirana s kompletom za povratno prepisovanje po navodilih proizvajalca. QRT-PCR smo izvedli s sistemom PCR v realnem času MiniOpticon (Bio-Rad, Šanghaj, Kitajska). Primeri so bili: IL-6 (NCBI: AF039224), naprej, acttcgtgcatgacttcagc; obratno, tctttgttggagggtgaggg. P53 (NCBI: AB082923), naprej, tggccatctacaagcagtca; obratno, ggtacagtcagagccaacct. Rezultati testa genske ekspresije so bili izračunani po metodi 2 -ΔΔCt in predstavljeni kot odstotek notranjega β-aktina za nadzor obremenitve.

Western blotting

Skupni protein je bil ekstrahiran iz celic in količinsko opredeljen s kompletom za testiranje proteinov Bio-Rad. V vsako vdolbino smo dodali enake količine beljakovin in jih frakcionirali z uporabo SDS-PAGE (elektroforeza gela z natrijevim dodecil sulfatom poliakrilamid). Plošče so bile prenesene na nitrocelulozno membrano. Po blokadi 5% posnetega mleka 1 uro smo membrano 1 uro inkubirali s primarnimi protitelesi (0, 2–0, 5 µg / ml) pri sobni temperaturi in nato 1 uro inkubirali s sekundarnimi protitelesi (konjugirani s hrenovo peroksidazo). Po vsaki inkubaciji smo izvajali pralne raztopine, puferirane s Trisom. Imunski kompleks je bil razvit z izboljšano kemiluminiscenco. Rezultate smo posneli z rentgenskimi filmi. Gostoto imunskih blotov smo ocenili s programsko opremo ImageJ.

Encimski imunosorbentni test (ELISA)

Ravni IL-6 in IL-17 v supernatantu v kulturi so bile določene s pomočjo ELISA z uporabo komercialnih kompletov reagentov (R&D Systems) po navodilih proizvajalca.

Ločitev k1106 celic in CD4 + T celic

Zmes k1106 celic in CD4 + T celic (Tregs) smo ločili s kompletom za izolacijo celic CD4 + T (Miltenyi Biotech; San Diego, CA, ZDA) po navodilih proizvajalca. Po pretočni citometriji je bila čistost izoliranih celic 99%.

Generacija Tregov

Celice CD4 + CD25 - T so bile izolirane iz mononuklearnih celic periferne krvi (izolirane od zdravih oseb; postopke je odobril Odbor za etiko človeške raziskave na Medicinski univerzi Guangzhou) z reagentom. Celice smo stimulirali z imobiliziranim anti-CD3 in anti-CD28 (5 μg / ml vsak) in gojili z 8 ng / ml TGF-β in 100 U / ml IL-2. Tri dni pozneje smo generirane iTregs izolirali z reagentom s pomočjo razvrščanja magnetnih celic. Čistost izoliranega Foxp3 + Tregs je bila glede na pretočno citometrijo več kot 95%.

Pretočna citometrija

Pogostost IL-17 + Foxp3 + T celic smo določili s pomočjo protočne citometrije. Celice smo fiksirali z 2% paraformaldehida 30 minut in nato 30 minut inkubirali z 0, 1% saponina. Po spiranju smo celice 30 minut blokirali z 1% govejim serumskim albuminom, nato pa celice obarvali s fluorescenčno označeno anti-IL-17 in protiteleso Foxp3 (1 µg / ml) 1 uro pri sobni temperaturi. Celice smo analizirali s pretočnim citometrom (FACSCanto II; BD Bioscience). Podatki so bili analizirani s programsko opremo FlowJo.

Ocena apoptoze

k1106 celice smo obarvali s propidijevim jodidom (PI) in reagentom Annexin V (Sigma-Aldrich) po navodilih proizvajalca. Celice smo nato analizirali s pomočjo protočne citometrije. Postavljena so bila vrata, ki izključujejo mrtve celice (celice PI + ). Nato smo določili pogostost celic Annexin V + v preostalih celicah.

Statistična analiza

Podatki so predstavljeni kot sredstvo ± sd Razlika med dvema skupinama je bila določena s Studentovim t- testom, ANOVA pa je bil uporabljen za več kot dve skupini. P <0, 05 je bila stopnja pomembnosti.

Rezultati

Kokultura s Tregs daje odpornost na obsevanje v k1106 celicah

Glavni terapevtski mehanizem obsevanja je induciranje apoptoze tarčnih celic. 15 Zato smo ocenili pogostost apoptotičnih celic k1106 po obsevanju. Rezultati so pokazali, da je obsevanje povzročilo apoptozo v k1106 celicah na obsevanje odvisno od odmerka (sliki 1A in B). Za testiranje vloge p53 pri celični apoptozi, ki jo povzroča sevanje k1106, smo kulturi dodali protitelo proti p53; apoptotičnih k1106 celic je bilo 7, 17% (obsevanje (8 Gy) + anti-p53 protitelo) v nasprotju s tistimi, ki so bile zdravljene samo z obsevanjem (8 Gy)) (slika 1Af). Rezultati kažejo, da je p53 vpleten v obsevanje, povzročeno s celico apoptozo k1106.

Image

Trege motijo ​​celično apoptozo, ki jo povzroča obsevanje k1106. ( a ) celice k1106 smo obsevali v različnih odmerkih, kot je označeno v vsaki podpaneli. Vrstico v b kažejo pogostost apoptotičnih celic k1106 v a . ( c ) celice k1106 (10 6 / ml) so bile gojene s kulturami Tregs (število Tregov je označeno v vsaki podpaneli: Število tregov / 10 6 k1106 celic; Tregovi niso bili obsevani). Tregovi CD4 + so bili zaklenjeni; preostale k1106 celice smo analizirali na apoptozo. Vrstice d označujejo frekvenco apoptotičnih celic k1106 v c . Anti-p53: Protitelesa proti p53 smo dodali kulturi pri 500 ng / ml. Podatki so predstavljeni kot sredstvo ± sd iz treh ločenih poskusov. * P <0, 01, v primerjavi s skupino A ( b ) ali BA ( d ). # CD4 + CD25 - T celice, ki se uporabljajo kot kontrola. k1106, Karpas1106; Treg, regulacijska T celica.

Slika v polni velikosti

Trege igrajo vlogo pri omogočanju rasti raka. 16 Da bi ugotovili, ali Tregs motijo ​​apoptozo rakavih celic, ki jo povzroča obsevanje, smo kokultivirali Tregs s k1106 celicami; celice so nato obsevali. Kot je bilo pričakovati, je kokultura s Tregs izrazito zmanjšala pogostost apoptotičnih k1106 celic na Treg-odvisen način (sliki 1C in D). Kot nadzor v ločenem poskusu so Tregs nadomestili celice CD4 + CD25 - T. Rezultati so pokazali, da celice CD4 + CD25 - T niso zavirale apoptoze k1106 celic (sliki 1Cf in D). Rezultati skupaj kažejo, da obsevanje lahko povzroči apoptozo celic k1106, ki jo lahko kokultura s Tregsom blokira.

Obsevanje povzroči izražanje IL-6 v celicah limfoma

Objavljeni podatki kažejo, da je IL-6 vključen v patogenezo limfoma in je povezan z odpornostjo proti sevanju. 17 Mehanizem ni znan. V ta namen smo obdelali celice k1106 (celična linija človeškega limfoma) z obsevanjem pri 0–8 Gy. Celice smo zbrali na koncu kulture in jih obdelali, da smo določili proizvodnjo IL-6. Rezultati so pokazali, da so bile v k1106 celicah, ki so bile samo z medijem, odkrite nizke ravni IL-6 (5, 5% β-aktinske mRNA). Obsevanje je znatno povečalo proizvodnjo IL-6 v k1106 celicah na obsevanje od odmerka (od 5, 5% (0 Gy) do 33, 8% (8 Gy) mRNA β-aktina). Z ELISA smo merili tudi raven IL-6 v kulturnih supernatantih. Rezultati so pokazali, da se je IL-6 povečal v supernatantih v kulturi, tudi na obsevanje, odvisno od odmerka, s 7, 9 pg / ml (0 Gy) na 87, 9 pg / ml (8 Gy). Za okrepitev podatkov so poskuse ponovili z drugo celično linijo limfoma, celicami BC-3. Obsevanje je povečalo proizvodnjo IL-6 s celicami BC-3 na odmerek odvisen od odmerka (Slika 2). Rezultati kažejo, da limfomske celice, celice k1106 in celice BC-3 izražajo IL-6, ki jih je mogoče obsevati z obsevanjem. Poleg tega se lahko ta IL-6 sprosti v zunajtelesno okolje.

Image

Obsevanje povzroči izražanje IL-6 v k1106 celicah. k1106 celice smo obsevali v kulturi, kot je opisano v besedilu; odmerek obsevanja označimo na osi x . Celične ekstrakte in supernatant smo analizirali z uporabo qRT-PCR, ELISA in Western blottingom. ( a, b ) Imunski bloti kažejo na vsebnost beljakovin IL-6 v k1106 celicah ( a ) in BC-3 celicah ( b ); palice označujejo integrirano gostoto imunskih blotov. ( c ) Vrstico kažejo vrednosti IL-6 mRNA. ( b ) Barji označujejo raven IL-6 v supernatantu. * P <0, 01 v primerjavi z odmerkom 0. Podatki so reprezentativni za tri neodvisne poskuse. ELISA, encimsko povezan imunosuorbentni test; k1106, Karpas1106; qRT-PCR, količinski RT-PCR v realnem času.

Slika v polni velikosti

Kokultura obsevanih k1106 celic in Tregs ustvarja IL-17 + Foxp3 + T celice

IL-6 ima v sodelovanju s TGF-β pomembno vlogo pri nastajanju Th17 celic. 18 Ker celice k1106 po obsevanju proizvajajo IL-6, smo predpostavili, da bodo obsevane k1106 celice povzročile IL-17 v Foxp3 + Tregs. Da bi preizkusili to hipotezo, smo s Tregsom v prisotnosti IL-2 3 dni soustvarili obsevane celice k1106. Celice smo zbrali in analizirali s pomočjo protočne citometrije. Rezultati so pokazali, da Tregovi niso proizvajali IL-17 v naivnih stanjih (sliki 3Aa in B); Kultiviranje s celicami k1106 (slika 3Ab in B) in zdravljenje z obsevanjem (slika 3Ac in B) sta povzročila izrazito izražanje IL-17 v celicah Foxp3 + T, ki se je še povečalo v kombinaciji kultiviranja s celicami k1106 in obsevanja (slika 3Ad in B). Proizvodnjo IL-17 smo ukinili v prisotnosti protiteles proti IL-6 (Slika 3Ae, Af in B). Ravni IL-17 in Foxp3 so bile pod mejami, ki jih je mogoče zaznati, v celicah k1106, gojenih s samostojnim medijem ali v k1106 celicah, obdelanih z obsevanjem (Slika 3Ag, Ah in B). IL-17 smo odkrili tudi v supernatantu kulture; ravni IL-17 so bile sorazmerne s pogostostjo IL-17 + Foxp3 + T celic (slika 3C). Rezultati kažejo, da obsevane k1106 celice inducirajo ekspresijo IL-17 v Tregsu.

Image

k1106 celice inducirajo IL-17 izražanje v Tregsu. k1106 celice (106 celic / ml) smo gojili s Tregs (2 × 10 5 celic / ml) pod pogoji, ki so označeni nad vsako ploščo s pikami. ( a ) Narisi pik kažejo pogostost celic IL-17 + Foxp3 + T. ( b ) Vrstice označujejo povzete podatke (srednja vrednost ± sd) a . ( c ) Palice označujejo raven IL-17 v kulturnih supernatantih. aIL-6: kulturi smo dodali nevtralizacijsko protitelo proti IL-6 v odmerku 1 µg / ml. Podatki predstavljajo tri ločene poskuse. k1106, Karpas1106; Treg, regulacijska T celica.

Slika v polni velikosti

IL-17 + Foxp3 + T celice modulirajo ekspresijo p53 v k1106 celicah

IL-17 + Foxp3 + T celice so povezane z rastjo raka11, vendar mehanizem ni popolnoma razumljen. Ker je p53 kritični protein za zaviranje rasti rakavih celic, 19 smo sklepali, da obsevane k1106 celice generirane IL-17 + Foxp3 + T celice motijo ​​izražanje p53 v k1106 celicah. V ta namen smo najprej ocenili izražanje p53 v k1106 celicah z ali brez obsevanja. Rezultati so pokazali, da se ekspresija p53 v k1106 celicah ni spremenila. Nato smo z obsevanjem obdelali kulturo k1106 celic in IL-17 + Foxp3 + T celic; ekspresija p53 je bila potisnjena v celicah k1106. Da bi razumeli, ali je potreben IL-17 pri sevanju p53 zaviranja v celicah k1106, smo kulturi dodali nevtralizirajoče protitelo proti IL-17, ki je odpravilo sevanje p53 supresije p1 v celicah k1106. V ločenih poskusih smo v kulturi obdelali celice k1106 z IL-17, ki je tudi zaviralo ekspresijo p53 (slika 4).

Image

T-celični IL-17 zavira ekspresijo p53 v k1106 celicah. k1106 celice so gojili s Tregs v razmerju 10 6 : 2 × 10 5 celic / ml in jih obdelali v kulturi, kot je označeno na osi x . Celice k1106 smo negativno izbrali in analizirali z qRT-PCR in Western blottingom. ( a ) Vrstico kažejo ravni mRNA p53. ( b ) imunski bloti kažejo na vsebnost beljakovin p53. ( c ) Palice označujejo integrirano gostoto imunskih blotov b . Odmerki IL-17, protiteles proti IL-17 (aIL-17) so bili 1 µg / ml. cAb: kontrolno protitelo (izotip IgG). Podatki palic so predstavljeni kot srednja vrednost ± sd * P <0, 05 v primerjavi s samo medijsko skupino. Podatki predstavljajo tri ločene poskuse. k1106, Karpas1106; qRT-PCR, količinski RT-PCR v realnem času; Treg, regulacijska T celica.

Slika v polni velikosti

IL-17 preprečuje obsevanje k1106 celične apoptoze, ki jo povzroči obsevanje

Podatki s slike 4 kažejo, da lahko IL-17 povzroči radioresistenco. Za preizkus te hipoteze smo celice IL-17 receptorjev in k1106 divjega tipa obdelali z obsevanjem. Kot je analizirala privzemna V / pretočna citometrija, je prisotnost IL-17 močno zmanjšala pogostost apoptotičnih celic k1106 na način, odvisen od odmerka IL-17 (slika 5a-d in f). V obsežnih celicah IL-17 receptorja k1106 (sl. 5G) smo po obsevanju opazili visoko frekvenco apoptotičnih celic, vključno s celicami PI + / Prilogein V + in PI - / Aneksin V + (sliki 5G) (sliki 5e in f).

Image

IL-17 preprečuje obsevanje k1106 celične apoptoze, ki jo povzroči obsevanje. Celice IL-17 receptorja in k1106 divjega tipa so bile izpostavljene sevanju pri 8 Gy v prisotnosti rekombinantnega IL-17 pri koncentracijah gradientov, ki so označene nad vsakim histogramom. ( a - e ) Točke grafične pretočne citometrije prikazujejo pogostost celic Annexin V + in Annexin V + / PI - k1106. ( f ) Vrstice označujejo zbrane podatke a - e (povprečje ± sd; * P <0, 01, v primerjavi s skupino A). ( g ) Imunski bloti kažejo rezultate uničevanja gena receptorja IL-17. Podatki predstavljajo tri neodvisne poskuse. k1106, Karpas1106; PI, propidijev jodid.

Slika v polni velikosti

Diskusija

Radioterapija se običajno uporablja kot učinkovito zdravljenje nodularnih limfomov, ki prevladujejo v zgodnji fazi, 20 pri katerih je velik odpor radioterapija. 21 Ta študija je pokazala, da po obsevanju k1106 limfomske celice izražajo IL-6; slednja sproži izražanje IL-17 v Tregsu. IL-17 je zaviral ekspresijo p53 v k1106 celicah, ki so ogrozile apoptozo in tako oslabile učinek obsevanja na induciranje apoptoze v k1106 celicah.

IL-6 proizvajajo številne vrste celic, vključno z monociti, fibroblasti, endotelnimi celicami in epitelijskimi celicami, kot so hematološke celične linije hematoloških. 22 Naši podatki so v skladu s prejšnjimi podatki, ki kažejo, da naivne k1106 celice proizvajajo zaznavne IL-6, ki jih lahko po obsevanju ureguliramo. Tudi drugi preiskovalci navajajo, da se podoben pojav pojavlja pri radioterapiji bolnikov z rakom. 23 V nasprotju s tem povečanje proizvodnje IL-6 korelira z radioresistenco v študijah celičnih linij raka in v kliničnih opazovanjih bolnikov z rakom, zdravljenih z obsevanjem. Alberti in sod. 24 kažejo, da izpostavljenost IL-6 spodbuja preživetje radioterapije tumorskih celic. Tako je za zdravljenje raka predlagano zdravljenje proti IL-6. 25 Vendar radiorespornosti rakavih celic ni mogoče odpraviti s protitelesom proti IL-6. 26 Sedanji podatki ponujajo razlago te dileme. Celice k1106 proizvajajo IL-6 po obsevanju; sčasoma ogrozi izražanje p53 in vpliva na mehanizem apoptoze v rakavih celicah.

Objavljeni podatki kažejo, da Tregs igrajo pomembno vlogo pri patogenezi raka. Wang in sod. 27 kažejo, da Tregs zavirajo specifične celice CD8 + T, specifične za tumor, s čimer oslabijo mehanizem za zdravljenje raka. Naši podatki razkrivajo še en vidik Tregs, ki vključuje pojav, s katerim lahko rakave celice uidejo pred imunskim nadzorom. Podatki kažejo, da Tregs po stiku z obsevanimi celicami k1106 izrazi IL-17, kar sčasoma zavira apoptozo v rakavih celicah. Podobne podatke poročajo tudi drugi, in sicer da povečan odziv Th17 spremlja indukcijo in napredovanje tumorja. Vendar nasprotujoče si ugotovitve poročajo, da je rast tumorja negativno povezana s povečano infiltracijo Th17 celic v tumorsko tkivo. 28 Poroča se tudi, da ionizirajoče obsevanje celega telesa pri miših povzroči več preživetja Trega. 29 Naši podatki kažejo, da je v okolju tumorja lahko še en vir IL-17, Tregs, ki sodelujejo pri preživetju in rasti tumorja. 30 TGF-β je kritična imunska regulacijska molekula CD4 + Foxp3 + Tregs. IL-6, ki izvira iz celice k1106, lahko sodeluje s TGF-β za pospeševanje izražanja IL-17 v Tregsu.

Protein p53 je pomembna molekula pri zatiranju rasti tumorja. Nenormalnost izražanja p53 je vključena v patogenezo raka. 9, 10 Naši podatki kažejo, da lahko radioterapija povečuje izražanje p53 v k1106 celicah, kar je povezano z apoptozo k1106 celic po obsevanju. Prejšnje študije kažejo, da so visoke ravni IL-17 povezane z nizko stopnjo p53 pri raku debelega črevesa in danke. 14 Naša raziskava ponuja nadaljnje dokaze, da lahko IL-17 zniža izražanje p53 v k1106 celicah in dodatno ogrozi mehanizem apoptoze v teh celicah.

Če povzamemo, podatki kažejo, da obsevanje povzroči izražanje IL-6 v k1106 celicah; IL-6 inducira Tregs, da proizvaja IL-17 v sodelovanju s TGF-β v Tregs. IL-17 zavira p53 v k1106 celicah, da ogrozi apoptozo, s čimer spodbudi preživetje k1106 celic. Podatki kažejo, da sta IL-6 in IL-17 možni tarči pri zdravljenju limfoma.