Inženirstvo campylobacter jejuni n-glikan za ustvarjanje učinkovitega piščančjega cepiva | znanstvena poročila

Inženirstvo campylobacter jejuni n-glikan za ustvarjanje učinkovitega piščančjega cepiva | znanstvena poročila

Anonim

Predmeti

  • Konjugirajo cepiva
  • Mikrobiom
  • Patogeni

Izvleček

Campylobacter jejuni je najpogostejši vzrok za človeški gastroenteritis po vsem svetu. Študije dodeljevanja virov kažejo, da so piščanci glavni rezervoar okužbe, zato bi izločanje C. jejuni iz perutnine bistveno zmanjšalo breme bolezni ljudi. Konstruirali smo glikokonjugatna cepiva, ki so združevali konzervirani C. jejuni N-glikan z beljakovinskim prenašalcem, GlycoTag ali se zlili v jedro lipopolisaharida Escherichia coli . Cepljenje piščancev z glikokonjugatom, ki je prikazan na beljakovini ali E. coli, je pokazalo do 10-log zmanjšanja kolonizacije C. jejuni in povzročilo N-glikanomske odzive na IgY. Poleg tega je bilo živo cepivo proti E. coli odstranjeno pred izzivom C. jejuni in ni bilo opaziti izbire za odporne različice kampilobakterja. Analize skupnosti piščančjih črevesja so pokazale, da živo cepivo ni spremenilo sestave ali zahtevnosti mikrobioma, kar je predstavljalo učinkovito in poceni strategijo za zmanjšanje C. jejunija pri piščancih in njegov nadaljnji vstop v prehransko verigo.

Uvod

Okužbe s kampilobakterjem (predvsem C. jejuni ali C. coli ) spadajo med najpogostejši vzrok za človeški gastroenteritis po vsem svetu 1, 2 . Ker je C. jejuni pogost član piščančjega črevesnega mikrobioma, je perutnina glavni vir okužbe pri ljudeh, kar ima za posledico razvoj vodne driske, hemoragični kolitis in v nekaterih primerih reaktivni artritis, Reiterjev sindrom, sindrom razdražljivega črevesja in Guillain-Barré sindrom 3, 4 . Tako bi zmanjšanje C. jejuni pri izvoru znatno zmanjšalo tveganje za izpostavljenost ljudi in imelo velik vpliv na varnost hrane in javno zdravje.

Ključni predpogoji, da se antigeni štejejo za kandidate za cepivo, so imunogenost in površinska izpostavljenost. Testirana so bila celična cepiva proti kampilobakterju in celične proteine ​​lizate zunanjih membran z nanodelci, vendar so pokazali omejeno zaščito 5, 6 . Bolj racionalni pristopi so vključevali uporabo specifičnih beljakovinskih antigenov bodisi očiščenih, na osnovi DNK bodisi danih z oslabljenimi sevi salmonele. Sem spadajo flagelin podenota FlaA 7, 8, beljakovina zunanje membrane MOMP 9, adhein Peb1 10, komponenta večdružinske črpalke izpusta CmeC 11, receptor za železov enterobaktin CfrA, lipoproteini CjaA in CjaC (posredovanje aminokislinskih prevozov) 12 . drugi 13, 14, 15, 16, 17, 18, 19 . Čeprav so bili v večini primerov sproženi odzivi na specifična protitelesa, je odziv zagotavljal bodisi omejeno zaščito (FlaA-LTB 20 ; rCmeC 21 ; CjaD 22 Dps 23 ), bil je usmerjen proti konformacijsko spremenljivim epitopom (MOMP) 24, 25, ni bil navzkrižno oz. zaščitni (FlaA) 26, 27 ali so bili rezultati zelo spremenljivi (CjaA ali CjaA-TetC) 22, 28, 29, 30, 31, odvisno od vzorčnega sistema ali načina dajanja. Pred kratkim je bilo predlagano, da jajčni rumenjak proizvaja α-CadF, α-MOMP in α-CmeC IgY kot potencialno uporabne kot pasivne imunoterapevtike 32, vendar njihova uporaba ni povzročila zmanjšanja kolonizacije kampilobakterjev pri piščancih 33 .

Ogljikovi hidrati predstavljajo drug razred biomolekul, ki se uspešno uporabljajo za ustvarjanje humanih cepiv proti glikokonjugatu, vendar trenutno niso na voljo za živali 34 . C. jejuni je bogat s površinskimi ogljikovimi hidrati, vključno z O- in N-vezanimi glikoproteini 35, 36, kapsularnimi polisaharidi (CPS) in lipooligosaharidi (LOS); in študije z uporabo kampilobakterskih struktur CPS kot antigenov kažejo v raziskavah cepiv za človeško uporabo 37, 38, 39 . Ker pa je bilo za C. jejuni do zdaj ugotovljenih 47 različnih serotipov CPS, je treba določiti število vrst CPS, potrebnih za dosego široke pokritosti z najpogostejšimi sevi C. jejuni, in jih spremljati zaradi premikov populacij 37 . Podobno spremenljivost struktur LOS in O-glikana omejuje uporabo teh ogljikovih hidratov kot potencialnih antigenov. Zanimalo nas je torej, ali smo ocenili uporabo N-glikana C. jejuni kot kandidata za cepivo pri piščancih. C. jejuni N-glikan je heptasaharid (GalNAc-α1, 4-GalNAc-α1, 4- [Glc-β-1, 3] GalNAc-α1, 4-GalNAc-α1, 4-GalNAc-α1, 3- diNAcBac; diNAcBac je 2, 4-diacetamido-2, 4, 6-trideoksi-D-glukopiranoza, GalNAc je N-acetilgalaktozamin in Glc glukoza) 40, 41, kar je skupno za vse preizkušene izolate C. jejuni in C. coli 35, 36 . N-glikan je konstitutivno ekspresioniran, dodan je večim periplazmatskim in membranskim beljakovinam, ščiti bakterije pred proteolitičnim napadom, je imunogen pri zajcih in ljudeh, ima vlogo pri prirojeni in prilagodljivi imunosti ter je potreben za kolonizacijo miši in piščancev, adherenca in invazija človeških epitelijskih celic in naravna sposobnost 35, 42, 43, 44 . Poleg tega so geni C. jejuni proteinske glikozilacije ( pgl ) prenosljivi v heterologne gostitelje, kot je E. coli 40, za proizvodnjo glikoproteinov za biotehnološko uporabo 44 .

Tukaj predstavljamo dve strategiji cepljenja. Za prvi pristop smo ustvarili glikoprotein, ki je sestavljen iz naravnega peptida C. jejuni (GlycoTag, GT), ki vsebuje 9 popolnih ponovitev bakterijskega zaporedja N-glikozilacije (D / E-X1-N-X2-S / T, kjer sta X1 in X2 lahko katera koli aminokislina, vendar prolin 45 ) in je zlahka spremenjen z do 9 ° C jejuni N-glikani, ko se GlyoTag spoji s ToxC. V drugem pristopu je bil uporabljen celoten celični sistem za prikazovanje celic N-glikanske strukture na zunanje jedro lipopolisaharida E. coli (LPS), ki je nadomestil naravni O-antigen. Ptice, cepljene z N-glikani, ki so bili izpostavljeni celicam na površini GlycoTag ali E. coli, so pokazale imunske odzive, specifične za N-glikan, in znatno znižanje ravni kolonizacije C. jejuni po izzivu s kampilobakterjem. Živo cepivo proti E. coli je bilo samoomejevalno in ni vplivalo na sestavo piščančjega črevesja, zato je zagotovilo poceni in učinkovito strategijo cepljenja za zmanjšanje C. jejuni pri perutnini.

Rezultati

Ekspresija cepiva proti jeklenki C. jejuni na osnovi beljakovin

Da bi ustvarili učinkovit protein-glikokonjugat za sintezo N-glikoproteinov v enem loncu in vivo , smo identificirali nov akceptorski peptid N-glikona, pridobljen s kampilobakterjem, GlycoTag, ki se nahaja na N-koncu Cj1433. GlycoTag vsebuje 9 popolnih ponovitev zaporedja aminokislin KIDLNNT, vključno z bakterijskim N-glikozilacijskim sprejemljivim zaporedjem DLNNT za pritrditev več C. jejuni N-glikanov, kadar so izraženi v E. coli (slika 1A). GlycoTag smo genetsko spojili s C-koncem okrnjene in neaktivne variante toksina C. difterije , ToxC in nadalje vstavili heksa-njegovo kodirno sekvenco na C-konec in signal izločanja pelB na N-konec konstrukt (slika 1B, C). Fuzija GlycoTag je bila izražena v E. coli v prisotnosti glikozilacije proteina C. jejuni ( pgl ) in očiščena do homogenosti (sl. 1D, plošče a in b). Analiza Western blota je potrdila modifikacijo fuzijskega proteina GlycoTag z do 9 C. jejuni N-glikani (sliki 1D, plošča b in c). Vsebnost ogljikovih hidratov na podlagi testa na fenol-žveplove kisline je bila izračunana v povprečju 3-4 N-glikana na molekulo beljakovin, kar ustreza približno 150 μg N-glikana na mg ToxC-GT-His 6 .

Image

(A) Prikazanih je prvih 150 aminokislin polipeptida C. jejuni Cj1433c. Zaporedje, ki vsebuje peptid GlycoTag (devet ponovitev [KIDLNNT]), se nahaja med dvojnimi zvezdicami (**). Podčrtano je bakterijsko N-glikozilacijsko zaporedje (DLNNT). (B) Shematski diagram ekspresije konstrukcije ToxC-GlycoTag-His 6 : pT7, inducibilni promotor IPTG; vodilno zaporedje pektat-lizaze B, pridobljeno s pelB , pET22b; toxC , okrnjena, netoksična različica toksina C. difterije ; Njegova 6, heksa-histidin-oznaka. (C) Prikazana je pričakovana N-vezana glikozilirana fuzijska beljakovina. ( D) Ekspresija in čiščenje glikoziliranega ToxC-GlycoTag-His 6 v prisotnosti pACYC184 ( pgl ) v E. coli BL21 (DE3). (a) 12, 5% SDS-PAGE celih celičnih lizatov BL21 / ToxC-GlycoTag-His 6 (L) in kombiniranih elucijskih frakcij po IMAC (E). Western blot z R1-4 antiserumom (a) kombinirane elucijske frakcije po IMAC, po (b) anionski izmenjevalni kromatografiji in (c) po izključitveni kromatografiji po velikosti. Na levi so označeni molekulski markerji (v kDa).

Slika v polni velikosti

Izražanje in potrjevanje cepiva cepiva E. coli - C. jejuni N-glikonsko cepivo

Da bi predstavili C.-jejuni N-glikan na celici E. coli , smo heptasaharid spojili z zunanjim jedrom LPS v mutantnem ozadju E. coli K12 O-antigena ( wzy :: kan ), da se izognemo potencialni polimerizaciji strukturo N-glikana (slika 2A). E.coli K12 ne proizvaja endogenega O-antigena (O16) zaradi naravno nastalih mutacij v genu wbbL (ramnosiltransferaze) 46 . Western blot z C. jejuni antiserumom, specifičnim za N-glikan (R1-4), je potrdil nastanek fuzije LPS-jedra-N-glikana s proizvodnjo imunoreaktivnega signala, ki je prisoten v E.-coli, obdelani s proteinazo K cozy wzy :: kan pACYC184 ( pgl mut ) celice, ki so migrirale okoli 15 kDa (slika 2B, pas 1). Ta signal je bil odsoten v celicah, obdelanih s proteinazo K, v praznem vektorskem nadzoru, E. coli wzy :: kan pACYC184 (slika 2B, proga 2). FACS analiza 2 × 10 4 fiksalnih celic formalina, sondiranih z R1-4 in fluorescentno označenimi (Alexa546) sekundarnimi protitelesi, je pokazala znatno povečanje fluorescence celic E. coli wzy :: kan ( pACYC184 ( pgl mut )) v primerjavi z E. coli wzy :: kan (pACYC184) (slika 2C) Videz vrha in geometrija pomenita prisotnost primerljive količine N-glikana C. jejuni na vsaki celici E. coli .

Image

(A) Risanka, ki prikazuje O-antigen ligazo (WaaL), odvisen od N-glikanske strukture, v jedro LPS E. coli . (B) Western blot proteinaze K prebavili celocelične lizate E. coli wzy :: kan ( pACYC184 ( pgl mut )), pas 1 in E. coli wzy :: kan (pACYC184), vozni pas 2 sondiran z R1-4 prikazano. Tvorba molekule LPS-jedra-N-glikana je označena s puščico. Na levi so označeni molekulski markerji (v kDa). (C) FACS analiza 2 × 10 * 4 celic E. coli wzy :: kan ( pACYC184 ( pgl mut )) v svetlo sivi barvi in E. coli wzy :: kan (pACYC184) v temno sivi barvi. Fluorescenčna intenzivnost je prikazana na osi x, števila celic (poljubne enote) pa so prikazana na osi y. (D) Prikazano je zaporedje fuzijskega produkta N-glikona v jedru LPS. Ostanki monosaharida, pridobljeni z glikanom, so prikazani rdeče. V jedru LPS so prikazani samo ostanki ogljikovih hidratov, ki jih lahko dodeli NMR. Velike črke se nanašajo na ostanke, navedene v dodatni tabeli 2. (E) NMR spekter očiščenega jedra LPS- C. jejuni -N-glikanska spojina. Prikazane so korelacije med anomernimi protoni (kot je navedeno). Zelena, COZY; rdeča, TOCSY; črna, ROŽNA.

Slika v polni velikosti

Očiščeno hibridno molekulo smo nadalje analizirali z NMR in potrdili, da se je ena enota N-glikana C. jejuni spojila z LPS-jedrom E. coli . Dodelitve N-glikana in jedra LPS E. coli so bili v dobrem soglasju z objavljenimi podatki 35, 47 (slika 2D, E, dodatna tabela 2): vse 1–4 povezave C. jejuni N- komponente glikana so povzročile transglikozidne učinke jedrskega prekrivalca 1: 4 in 1: 6, z analizo glavne kopice so bili ugotovljeni vsi signali zunanje lPS -jedro l- glicero - d - manno- heptoze (Hep, L v tabeli S2). korelacij in N-glikan je bil povezan z O-7 Hep (slika 2D). Toda namesto diNAcBac, ki tvori izvorni C. jejuni N-glikan, ki zmanjšuje končni sladkor, smo na tem položaju našli GlcNAc, ki smo ga že opazili pri izražanju strukture C. jejuni N-glikan v E. coli 48 .

Cepiva na osnovi N-glikana zmanjšujejo kolonizacijo C. jejuni pri piščancih

V 35-dnevnem modelu SPF Leghorn s piščančji izzivi smo preizkusili učinkovitost vsakega sestavka cepiva ter najboljši odmerek in pot uporabe. Cepiva proti glikoproteinu so injicirali v dojko ali v nogo, celično celična cepiva (živa ali inaktivirana) pa peroralno odmerjala. Najprej smo določili odziv C. jejuni in odmerke beljakovinskih glikokonjugatov (slika 3A). Ptice, ki so bile na dan 28. okužene z 1 × 10 * 2 in 1 × 10 * 6 C. jejuni celicami, so pokazale primerljive stopnje kolonizacije. Cepljenje v dojki v 7. in 21. dneh s 5 µg ali 100 µg očiščenega glikoziliranega proteina ToxC-GT je povzročilo statistično pomembno zmanjšanje kolonizacije bakterij (p-vrednosti <0, 05 in <0, 005) po izzivu z 1 × 10 * 2 C. jejuni . V skupinah z zdravljenjem, ki so prejele večji odmerek C. jejuni (1 × 10 * 6), se je bakterijska obremenitev znatno zmanjšala pri pticah, ki so prejele večji odmerek cepiva (p-vrednost> 0, 05). Ptice, ki so prejele nižji odmerek cepiva, niso pokazale statistično pomembne razlike v primerjavi z necepljeno skupino (p-vrednost> 0, 05). Podobno je cepljenje z ne-glikoziliranim ToxC-GT privedlo do podobnih stopenj kolonizacije v primerjavi s pozitivno kontrolno skupino (sl. 3A). Pri negativnih kontrolnih pticah niso opazili nobene C. jejuni nad mejo zaznave 1 × 10 * 2 CFU / gram cecal. Nato smo preizkusili, ali mesto injiciranja vpliva na učinkovitost beljakovinskega cepiva (slika 3B). Stopnja kolonizacije po okužbi z 1 × 10 * 2 C. jejuni je pri pticah s pozitivno kontrolo znatno padla z 2 × 10 * 10 na 2 × 10 * 6 (p-vrednost <0, 005) in 9 × 10 * 2 (p-vrednost <0, 005) enote, ki tvorijo kolonije (CFU) na gram cekalne celice pri pticah, cepljenih v prsih ali nogi v 7. in 21. dneh. Ravni C. jejuni pri pticah z negativnim nadzorom so bile pod mejo odkrivanja. Za primerjavo smo tudi preizkusili učinkovitost inaktiviranih celic E. coli, ki prikazujejo N-glikan, ki so ga dajali s peroralno zaužitjem. Za to zdravljenje so opazili statistično pomemben padec (p-vrednost <0, 005) obremenitve C. jejuni po izzivu na 3 × 10 * 6 CFU na gram vsebnosti cecala (slika 3B). Nato smo testirali živo cepivo proti E. coli . V dveh neodvisnih raziskavah so ptice peroralno cepili s sevom E. coli, ki je na svoji površini izrazil jedro LPS-N-glikana. Kolonizacija C. jejuni po okužbi se je v primerjavi s stopnjami kolonizacije pri necepljenih pticah znatno zmanjšala (p-vrednost <0, 005) (slika 3C, D). V nasprotju s tem niso opazili statistično pomembne razlike (p-vrednost> 0, 05) v stopnjah kolonizacije pri pticah, ki so prejemale izogeni sev E. coli, ki na svoji površini ne izraža N-glikanske strukture C. jejuni (slika 3D).

Image

(A – D) Prikazane so stopnje kolonizacije C. jejuni 81–176. Vsaka podatkovna točka predstavlja eno ptico, sive palice predstavljajo srednjo stopnjo kolonizacije C. jejuni za vsako skupino, izraženo kot CFU na gram cecalnega materiala (meja zaznavnosti, 1 × 10 * 2 CFU). Ptice v negativnih kontrolnih skupinah (PBS) niso bile cepljene, niso bile okužene; ptice v pozitivnih kontrolnih skupinah (+ ve) niso bile cepljene, vendar so bile okužene s C. jejuni 81–176. (A) Skupine za zdravljenje so vključile ptice, ki so bile cepljene z injiciranjem 100 µg ali 5 µg glikoziliranega proteina ToxC-GT-His 6 ali ne-glikoziliranega proteina ToxC-GT-His 6 (kontrola) v dojko 7. in 21. dni pred izziv z 10 * 2 ali 10 * 6 CFU (kot je navedeno) C. jejuni 81–176 dne 28. ( B ) Skupine za zdravljenje so vključile ptice, ki so bile cepljene z injiciranjem 5 μg glikoziliranega proteina ToxC-GT-His 6 v dojke ali v nogi 7. in 21. dan in vzporedno, ptice, ki so jih oralno odmerili z 10 in 8 inaktiviranih celic E. coli, ki izražajo N-glikan C. jejuni na svoji površini pred izzivom z 10 x 2 CFU C. jejuni 81–176 dne 28. (C) . Ptice v skupini za zdravljenje so ustno odmerili 7. in 21. dan z 10 * 8 živimi celicami E. coli, ki so na svojem površju izrazile N-glikan C. jejuni pred izzivom z 10 * 2 CFU C. jejuni 81–176 dne 28. (D) Pticam v skupinah za zdravljenje so bile ustno odmerjene 7. in 21. dan z 10 * 8 živimi celicami E. coli, ki ne izražajo N-glikana (kontrolna skupina) ali 10 * 8 živih celic E. coli, ki izražajo C. jejuni N-glikan na njihovi površini pred izzivom z 10 x 2 CFU C. jejuni 81–176 dne 28. (E) Odzivi na protitelesa, specifična za N-glikan. Rezultati ELISA so uporabili 1:10 piščančje serume iz krvavitev, odvzetih pred izzivom C. jejuni (28. dan). Vsaka točka predstavlja odziv protiteles, izmerjen pri OD 405 za vsakega posameznega piščanca. Sive palice predstavljajo mediano za vsako skupino. (A – E) Navedene so statistične razlike med skupinami: ns, ni statistično pomembne razlike ( p- vrednost <0, 05); * in ** označujeta statistično pomembne razlike z vrednostmi p > 0, 05 oziroma> 0, 005.

Slika v polni velikosti

Ugotovili smo tudi relativne ravni E. coli pri pticah, ki so prejele živo cepivo. Pred prvo odmeritvijo E. coli (7. dan) niso odkrili nobene E. coli . Ravni E. coli so se znižale, ko so jih spremljali 2, 5 in 9 dni po prvem cepljenju (dodatna tabela 3 in dopolnilne metode). Hitrejše zmanjšanje E. coli je bilo opaženo po drugem zaužitju (21. dan), pri čemer ni bilo zaznati E. coli do 28. dneva za sev cepiva in nizke ravni E. coli pri pticah, ki so prejemale kontrolni sev. 35. dne ni bilo odkrito E. coli, kar jasno kaže, da se cepilni sev samoomeji. Zanimivo je, da se živo cepivo proti E. coli, ki izraža N-glikan, v primerjavi z kontrolnim sevom E. coli hitreje očisti.

Cepljene ptice razvijejo odziv na Ig-specifičen IgY

Imunski odzivi, specifični za N-glikan, so bili določeni v serumih, odvzetih 28. dne pred izzivom C. jejuni (slika 3E). Povprečni imunski odziv na vsako cepivo je ustrezal stopnji zaščite pred kolonizacijo C. jejuni ; vendar najvišji posamezni titri niso v korelaciji s pticami z najnižjimi stopnjami kolonizacije C. jejuni . Najvišje titre s statistično pomembnim zvišanjem ravni IgY v primerjavi z negativnimi pticami pri kontrolnih skupinah so opazili pri pticah, cepljenih z živim sevom E. coli, ki na svoji površini izraža N-glikan (p-vrednost <0, 005), ki mu sledijo ptice, ki prejeli inaktivirani sev (p-vrednost 0, 1). Čeprav so nekatere ptice, ki so prejele beljakovinske glikokonjugate, tudi v primerjavi z negativnimi kontrolnimi pticami povečale raven IgY, specifičnih za glikan, primerjava mediane ni povzročila splošnega statistično pomembnega povečanja (p-vrednosti> 0, 05). Pri necepljenih pticah, pri pticah, ki prejemajo sev E. coli, ki ne izražajo N-glikana, in pri pticah, ki so prejemale ne-glikoziliran ToxC-GT-His 6 (ni prikazano) ni bilo zaznati titrov protiteles, specifičnih za N-glikan. ) kar kaže, da je bilo opaženo povečanje titrov IgY posledica prisotnosti N-glikana C. jejuni na površini E. coli ali ko je N-vezan na protein ToxC-GT His 6 .

Cepljenje piščancev ne povzroča sevov, odpornih na C. jejuni

Čeprav so nekatere ptice, cepljene z živim sevom, ki izražajo N-glikan E. coli, pokazale, da kolonizacije C. jejuni ni mogoče zaznati, imajo druge še vedno nizko stopnjo kolonizacije (sl. 3C, D). Tiste izolirane kolonije C. jejuni so bile testirane z N-glikanom specifičnim R1-4 antiserumom (dopolnilna slika 1). Vsaka kolonija je pokazala močno reaktivnost z antiserumom, ki je preverjal, da ti izolati še vedno izražajo N-glikan in da ni bilo nobene izbire za variante C. jejuni, ki nimajo strukture N-glikana (dopolnilna slika 1). Celocelični lizati divjega tipa, opaženi kot pozitivna kontrola, so povzročili podobno intenzivnost pege ob vizualni primerjavi s kolonijami, ki so pozitivne na N-glikan, medtem ko smo opazili le reaktivnost v ozadju, ko smo opazili celocelične lizate N-glikozilacije C. jejuni mutant ( pglB ), kar kaže, da je opažena reaktivnost res odvisna od prisotnosti N-glikana.

Cepljenje preprečuje kolonizacijo C. jejuni brez sprememb v rezidenčni bakterijski skupnosti v piščančjem črevesju Leghorn

Pri pticah iz pozitivnih kontrolnih skupin, ki so jih prvotno cepili z 1 × 10 2 CFU C. jejuni in so pozneje pokazali stopnjo kolonizacije do 1 × 10 * 10 CFU / gram cekalne vsebnosti, je prisotnost C. jejuni povzročila premik v globalna struktura rezidenčnih bakterijskih skupnosti, kot je prikazano v nemetričnem večdimenzionalnem merjenju (NMDS), ki temelji na metrikah Braya Curtisa (slika 4A) in PCoA na tehtanih UniFrac metrikah (podatki niso prikazani). Cepljenje z živim cepivom, ki temelji na E. coli, je spremenilo te spremembe, zaradi česar se je mikrobiota črevesja cepljenih ptic preusmerila nazaj na sestavo, opaženo v negativni kontrolni skupini, ki ni prejela C. jejuni . Ocena raznovrstnosti alfa (znotraj vzorcev) ni pokazala pomembnih razlik med tema dvema skupinama zdravljenja (slika 4B). Inokulacija s C. jejuni je povzročila veliko kolonizacijo vrste, kar je povzročilo znatno povečanje relativne številčnosti mikrobov iz vrste Proteobacteria (povečala se je z 12% na 35%), družine Campylobacteracae (povečala z manj kot 0, 001 na 19% ), rod Campylobacter (povečal se je z manj kot 0, 001% na 19%) in vrsta (OTU) C. jejuni / C. subantarktik (povečan z manj kot 0, 001% na 22%) (slika 4C), kar kaže, da se C. jejuni ustanovi v piščančjih črevesjih, ne da bi pri tem zmanjšal raznolikost ali spremenil prebivalstvo, podpiral njegov nepatogeni status. Cepljenje je povzročilo znatno zmanjšanje kolonizacije C. jejuni (manj kot 0, 001%, p <0, 05), kar je podprlo naše ugotovitve na podlagi kulture. Zaznanih je bilo nekaj drugih pomembnih sprememb mikrobiote. OTU, povezan s Clostridium tercium, se je zmanjšal z 20% v negativni skupini, na 11% v pozitivni, nadalje pa se je zmanjšal na 6% v cepljeni skupini (p = 0, 0444) (slika 4C).

Image

(A) NMDS ordinacijski načrt cekalnih bakterijskih skupnosti, ki temelji na metriki razdalje Bray-Curtis. Kolonizacija s C. jejuni (pozitivna skupina) povzroči premik v globalni mikrobni sestavi črevesja Leghorn, medtem ko struktura bakterijske skupnosti pri cepljenih pticah spominja na strukturo ptic iz negativne kontrolne skupine. (B) Zdravljenje s cepivom ne povzroči sprememb v raznolikosti alfa, merjeno s Simpsonovim indeksom raznolikosti. (C) Sestava bakterijske skupnosti celic na ravni vrste, družine, rodu in vrstah (OTU).

Slika v polni velikosti

Diskusija

Ugotovljene so bile tri glavne strategije za zmanjšanje okužbe s C. jejuni pri perutnini 49 : (1) zmanjšanje izpostavljenosti okolju (npr. Ukrepi za biološko varnost), (2) meritve za zmanjšanje C. jejuni v piščančjih črevesjih (npr. Cepljenje) in (3 ) uporaba protimikrobnih nadomestnih zdravil (npr. zdravljenje z bakteriofagi ali zdravljenje z bakteriocinom). Ti ukrepi se, razen ukrepov za biološko varnost, še vedno razvijajo. Aktivna imunizacija perutnine bi bila privlačna alternativa dajanju antibiotikov za zmanjšanje številčnosti C. jejuni pri domačem gostitelju in posledične diarejske bolezni pri ljudeh.

Učinkovito cepivo proti C. jejuni pri perutnini se mora spoprijeti s tremi glavnimi izzivi: (1) identifikacija navzkrižno zaščitnih antigenov, (2) indukcija hitrega in močnega imunskega odziva in (3) razvoj novih adjuvansov na nadalje spodbujajo imunost proti C. jejuni 50 . C. jejuni N-glikan izpolnjuje vse te zahteve. Površinsko je izpostavljen 35, 42, imunogen pri ljudeh in zajcih 35, 51, 52 in, kot je prikazano v tej študiji, pri piščancih povzroči zaščitni imunski odziv. Poleg tega lipid A, ki je prisoten v živem cepivu proti E. coli, pa tudi uporaba toksoida ToxC v ToxC-GT- C. jejuni N-glikan-Njegov 6 glikokonjugat deluje kot naravni pripomočki za spodbujanje imunskega sistema. Ker je N-glikan edina glikokonjugatna struktura, ohranjena med vsemi izolati C. jejuni 35, 36, 53, pričakujemo, da je imunski odziv, specifičen za N-glikan, navzkrižno zaščiten.

Tako naš rekombinantni glikoprotein (GlycoTag) kot celoten celični pristop k dostavi povzročita multivalentno predstavitev N-glikana. Izkazalo se je, da je multivalentna predstavitev epitopov ogljikovih hidratov streptokoka iz skupine B bistveno učinkovitejša od trenutno na voljo cepiv, ki imajo nižje razmerje med ogljikovimi hidrati in beljakovinami 54 . Podobno je bilo cepivo z dvema do petimi CPS na CRM197 dovolj za sprožitev zaščitnega imunskega odziva pri miših in opicah pred izzivom s C. jejuni 81–176 39 . Čeprav smo opazili zmanjšanje kolonizacije C. jejuni z dajanjem večjih odmerkov cepiva glikokonjugata po izzivu z 10 * 2 in 10 x 6 C. jejuni CFU, je spodnji izzivni odmerek verjetno bolj odraz naravnih razmer, ko C. jejuni se najprej vnese v jato, npr. Prek muh, ki vstopijo v perutnino 55, 56 . Študije hranjenja z umetnimi muhami so pokazale, da koncentracija C. jejuni ni višja od 1 × 10 * 4 CFU 57 in pokazalo se je, da je 40 enot C. jejuni, ki tvorijo kolonije, dovolj za sprožitev piščančje kolonizacije, vendar pa je nalezljiva doza variira med sevi C. jejuni 58, 59 .

Predstavitev N-glikana na celici E. coli je mogoča zaradi medsebojne povezanosti endogenega O-antigena LPS in heterolognega poti biosinteze N-glikana 60, 61, 62 in njihove potrebe po undekaprenilfosfatu za sestavljanje sladkorja. Zanimivo je, da lahko WecA, začetna transferaza GlcNAc, ki je vključena v enterobakterijsko biosintezo skupnega antigena in O-antigena, nadomesti funkcijo C. jejuni PglC, vendar raje UDP-GlcNAc kot UDP-diNAcBac kot začetni monosaharid 61 . Čeprav sta pglC (na pACYC184 pgl mut ) in kromosomska kopija wecA prisotna v sevu živega cepiva in je bilo dokazano, da so diNAcBac in GlcNAc, ki vsebujejo C. jejuni N-glikonski lipidno povezani oligosaharidi (LLO), nastali hkrati, ko pgl lokus je izražen v E. coli 48, za GlcNAc je bilo ugotovljeno, da je sladkor, ki povezuje O-7 l- glicero - d - manno- heptoze LPS-jedra. Ena od razlag bi lahko bila, da čeprav je bilo ugotovljeno, da E.-coli K-12 WaaL O-antigen ligazi nima substralne specifičnosti 63, so prednostni LLO-ji z ​​GlcNAc, ki vsebujejo N-glikan, prednostni pred LNA-ji, ki vsebujejo diNAcBac. Lahko bi trdili, da lahko odsotnost diNAcBac negativno vpliva na zaščitni imunski odziv proti C. jejuni N-glikanu, vendar smo že pred tem dokazali, da je imunski odziv proti N-glikanu usmerjen proti nereducirajočim končnim ostankom 35, 64 65, 66 .

Živi cepiv proti E. coli zagotavlja boljšo zaščito proti C. jejuni v primerjavi z inaktiviranim E. coli, verjetno zaradi daljših časov izpostavljenosti antigenu pri piščancu in zaradi indukcije močnejšega imunskega odziva sluznice, ki ga izvaja živ nosilec. Dejstvo, da se živa E. coli, ki izraža N-glikan, hitreje odstrani po drugem (spodbujevalnem) odmerku v primerjavi z E. coli , je lahko posledica tega imunskega odziva, specifičnega za N-glikan, ki ga povzroči ta sev, kar zmanjša tveganje za pojav kontaminacija mesa s sevom cepiva. Živo cepivo proti E. coli preprečuje kolonizacijo C. jejuni, ne da bi spremenilo mikrobioto avtohtonih piščančjih črevesja, kar kaže na specifičen imunski odziv brez škodljivih učinkov na sestavo mikrobiomov.

Pokazali smo, da je N-glikan še vedno prisoten na vseh izolatih C. jejuni po prehodu skozi cepljene ptice, kar kaže, da ni bilo izbire za različice C. jejuni, negativne na glikan. To ni presenetljivo, saj pgl genom primanjkuje homopolimernih traktov, ki so podvrženi visokofrekvenčnim mutacijam na drsni trak, kot kažejo geni, ki kodirajo C. jejuni O-vezane glikane, LOS in CPS strukture 37, 67, 68, 69, 70, 71 . V malo verjetnem primeru, da bi prišlo do selekcije proti N-glikanu, te celice ne bi mogle preživeti v piščančjem črevesju, saj je sam N-glikan potreben za piščančjo kolonizacijo in ščiti celico pred proteolitičnim napadom s piščančjimi proteazami 35, 42, 43, 44 .

Uporaba ohranjene N-glikanske strukture v sestavkih cepiv znatno zmanjša C. jejuni na izvoru. Pokažemo, da zdravljenje z glikokonjugati na osnovi beljakovin znatno zmanjša kolonizacijo C. jejuni po izzivu z organizmom neodvisno od časa injiciranja ali mesta nanosa. Peroralno cepljenje z živimi celicami E. coli, ki izražajo N-glikan na njihovi površini, je znatno zmanjšalo kolonizacijo. Celotne ravni protiteles IgY so bile v skladu s stopnjo zaščite po izzivu, kar kaže, da je odziv zaščiten.

Uporaba živih E. coli kot samoomejevalnega nosilca antigena N-glikan je ugodna v primerjavi s prej uporabljenimi sistemi za dostavo na osnovi salmonele, ki bi jih bilo težko uvesti v zvezi s standardi hrane v nekaterih državah. Poleg tega je cepivo proti E. coli enostavno izdelati in dati v primerjavi z uporabo posameznih beljakovinskih antigenov, ki jih je treba očistiti v velikem obsegu in jih morda dati s podkožnimi injekcijami, da dosežemo svoj polni potencial. Ta dejstva bodo omogočila testiranje cepiva v obsežnih aplikacijah z uporabo drugih priljubljenih pasem piščancev za ustvarjanje poceni cepiva za zmanjšanje C. jejuni .

Metode

Bakterijski sevi, plazmidi in rastni pogoji

Sev C. jejuni 81–176 je bil gojen na agelu Mueller Hinton (MH) (Difco) pri 37 ° C v mikroaerobnih pogojih (85% N2, 10% CO 2 in 5% O2). Sovi Escherichia coli so bili gojeni na Luria Bertani (LB) ali 2-kratnem YT (2xYT) mediju, dopolnjenem z ampicilinom (Amp), kanamicinom (Km) ali kloramfenikolom (Cm) s končno koncentracijo 100, 50 ali 20 µg / ml kjer je potrebno. Karmali dodatek (po potrebi) je bil dodan v skladu z navodili proizvajalca (Oxoid). Bakterijski sevi in ​​plazmidi so povzeti v dodatni tabeli 1.

Bioinformatske analize proteoma C. jejuni

FASTA proteinske sekvence vrste C. jejuni, ki so na voljo na strežniku EMBL (//www.ebi.ac.uk/), so bile uporabljene za iskanje motivov aminokislin s pomočjo programske opreme za iskanje vzorcev beljakovinskega vzorca. Sequence Manipulation Suite: Protein Pattern Find (// Protein Pattern Find (// bioinformatics.org/sms2/protein_pattern.html, z (d | e) .n (s | t) kot iskalnimi merili, ki ustrezajo zahtevi za bakterijsko N-vezano mesto glikozilacije D / E-X1-N-X2- Ker položaji X1 in X2 ne prenašajo prolina 45, smo dobljene sekvence ročno raziskali za pojav te aminokisline in jih izključili, če so bile prisotne, nato pa so bile v prilogah / domnevnih funkcijah preostalih proteinov pozneje (ročno) poiskane ključne besede "periplazmatski", "membrana" in "izločeni proteini" in proteini so bili razvrščeni glede na pogostost prisotnih mest glikozilacije.

Kloniranje, ekspresija in validacija glikoziliranega fuzijskega proteina GlycoTag

The gene encoding an enzymatically inactive and nontoxic form of the diphtheria toxin (toxoid, toxC ) from Corynebacterium diphtheriae was amplified from plasmid pPDT1 72 with oligonucleotides CS-378 (5′- ATATATATCCATGGCTGCTGATGATGTTGTTGATTC-3′) and CS-379 (5′- ATATACTCGAGTCGCCTGACACGATTTCCTGCACAGG3′) to introduce NcoI and XhoI sites, respectively. The obtained NcoI-XhoI digested PCR product was inserted into plasmid pET22b cut with the same enzymes translationally fusing the gene to the plasmid-derived pelB secretion sequence for the transport of the product into the periplasmic space. A 271 bp DNA fragment including the 9 N-glycosylation sequon repeat (GlycoTag, GT) was amplified from chromosomal DNA of C. jejuni 11168 with oligonucleotides CS-334 (5′ AAACTCGAGTTCATAAAAAATTTCAAGC3′) and CS-335 (5′ ATATCTCGAGCTCTTTTTTTAATTGCG3′) inserting XhoI sites in the 5′ and 3′ prime ends. To fuse the GlycoTag sequence to the C-terminus of ToxC, the XhoI digested PCR product was inserted into plasmid pET22b toxC , linearized with XhoI, and dephosphorylated with shrimp alkaline phosphatase (SAP). The orientation of the GT sequence was confirmed by sequencing. This resulting construct expresses the pelB - toxC -GT fusion including a C-terminal pET22b derived Hexa-Histidine (His 6 ) tag. Protein expression was performed in E. coli BL21(DE3) in the presence of plasmid pACYC184 ( pgl ) 40 . An overnight culture was used to inoculate 1 litre of 2xYT broth to an OD 600 of 0.1. Cells were grown at 37 °C until an OD 600 of 0.6 was reached. Cells were cooled on ice for 30 min, protein expression was induced by addition of IPTG to a final concentration of 0.5 mM, and cells were grown for an additional 18 hrs at 30 °C. Cells were cooled on ice, harvested by centrifugation (15 min 4, 200 × g, 4 °C), and resuspended in PBS supplemented with an EDTA free protease inhibitor cocktail according to the instructions of the manufacturer (Roche). Cells were disrupted in a cell disrupter (Constant Systems, Ltd), the resulting suspension was centrifuged for 30 min at 13, 000 × g, 4 °C, and the resulting supernatant was loaded onto a 1 ml Ni-NTA column using the AEKTA purification system (GE Healthcare). After an initial wash step with 10 mM imidazole in PBS, an imidazole gradient was applied from 10–250 mM over 50 column volumes. Elution fractions that contained the ToxC-GT-His 6 protein were analyzed by 12.5% SDS-PAGE, combined and the glycosylation status of ToxC-GT-His 6 was verified by Western blotting as described previously 35 . The ToxC-GT-His 6 proteins were dialyzed against 25 mM potassium phosphate buffer, 10 mM NaCl, pH 7.2, and further purified by anion exchange chromatography on a 2.5 ml MonoQ column (GE Healthcare) with a 100 ml linear gradient of NaCl (10–500 mM) in 25 mM potassium phosphate, pH 7.2. Fractions containing ToxC-GT-His 6 were desalted by size exclusion chromatography on a Sepahadex 75 column using PBS as the mobile phase. Fractions that contained the target protein as determined by 10% SDS-PAGE and Western blotting with R1-4 antisera were combined. The protein concentration was determined using the BioRad DC protein assay kit according to the instructions of the manufacturer and adjusted to 0.2 mg/ml. The N-glycan amount per protein was calculated after determination of the carbohydrate content of ToxC-GT-His 6 using the colorimetric phenol-sulfuric assay 73 and known concentrations of purified fOS (free oligosaccharides) 74 as a standard. If necessary, centrifugal filters (Amicon, 10 kDa cut-off) were used to concentrate the proteins. Proteins were stored at 4 °C until further use.

Preparation of E. coli cells for downstream processing

E. coli K12 wzy :: kan (KEIO collection 75 ) was transformed with plasmids pACYC184 ( pgl mut ) and pACYC184. Whole cells for vaccination and verification of antigen expression were prepared as follows: overnight cultures were used to inoculate fresh 2xYT broth to an OD 600 of 0.1. Cells were grown at 37 °C without antibiotics until an OD 600 of at least 1.0 was reached. Cells were cooled on ice (10–15 min), harvested by centrifugation (5 min 4, 200 × g, 4 °C), washed twice in ice-cold PBS and adjusted to an OD 600 of 1.0 using the same buffer.

Cell counts were determined as follows: aliquots of a 10-fold dilution series (prepared in PBS) of cells adjusted to an OD 600 of 1.0 were plated on 2xYT plates containing Km and Cm. Colony forming units (CFUs) were in a range of 0.9 to 1.1 × 10*8 bacteria per 1 ml of OD 600 = 1.0 cells. To adjust the vaccination dose, cells were resuspended in 1/3 of the original OD 600 = 1.0 volume resulting in 3 × 10*8 cells per ml (or 1 × 10*8 cells in 300 μl = one dose). Alternatively cells were cross-linked/fixed using 1% formaldehyde in PBS for 1 h at 4 °C as previously described 76, centrifuged (5 min 4, 200 × g, 4 °C), and washed 4-times with ice-cold PBS. Cross-linked cells were resuspended in PBS that corresponded to 1/3 of the original volume of the OD 600 = 1.0 cell suspension to obtain 3 × 10*8 cells/ml (that equals 1 × 10*8 cells in 300 μl that were needed for one dose of the inactivated whole cell-based vaccine).

Preparation of protein free cell extracts

Glycolipid extracts were prepared as previously described 77 . Briefly, E. coli cells of a culture equivalent to an OD 600 of 1.0 (prepared as described above) were centrifuged, resuspended in 100 μl of 1 × Laemmli sample buffer, and heated to 95 °C for 10 min. Proteinase K (Fermentas) was added to a final concentration of 200 μg/ml and the sample was incubated at 60 °C for 1 h. Glycolipid species from the proteinase K-digested whole cell lysates were separated by 12.5% SDS-PAGE, transferred to PVDF membranes and analyzed by Western blotting as previously described 35 .

Cross absorption of R1 antiserum

C. jejuni N-glycan-specific antiserum (R1 35 ) was cross absorbed using whole cells of E. coli wzy :: kan (pACYC184) as follows: the pellet of 1 ml of OD 600 = 1.0 culture was blocked with 1 ml PBS and 5% skim milk for 20 min. Cells were spun for 5 min at 4, 200 × g, resuspended and incubated with 1 ml of R1 serum for 30 min on ice with occasional inversion of the tube. Cells were spun out of the mixture and the supernatant was used to repeat the procedure 4X. The resulting serum (R1-4) that was depleted of E. coli -specific antibodies was used for downstream analyses.

Western blotting

Western blots were performed as previously described 35 . C. jejuni -N-glycan-specific antiserum, R1, or cross-absorbed R1 (R1-4) was used at a 1:7, 500 dilution, anti-His antiserum (Santa Cruz Biotech) was used at a 1:1, 000 dilution, and AP-conjugated rabbit and mouse antisera (Santa Cruz Biotech) were used at 1:2, 000 dilutions. Immunoreactive bands were visualized directly on the PVDF membrane using the NBT-BCIP detection reagents (Promega) according to the instructions of the manufacturer.

Colony lifts

Cecal content dilutions were plated on MH agar supplemented with the Karmali supplement and Trimethoprim. Colony lifts were performed as previously described 78 . Immunodetection was done as for Western blotting (described above).

Fluorescence activated cell sorting (FACS)

E. coli cells were adjusted to OD 600 of 1.0 and 1 ml was pelleted by centrifugation and resuspended in 1 ml blocking solution (PBS, 5% skim milk). Cells were probed with R1-4 and Alexa Flour-546 conjugated anti-rabbit antiserum, and analyzed by FACS (on a LSR-Fortessa Flow Cytometer). FACS data were processed with the FACS Diva software. DAPI counter-staining was used to identify and gate for intact cells.

NMR

Glycolipids were prepared from cell pellets obtained from eight litres of OD 600 = 1.0 E. coli wzy :: kan (pACYC184 pgl mut ) cells grown as described above. LPS was extracted by phenol-water, dialyzed, treated with acetic acid (AcOH) to precipitate nucleic acids, dialyzed, dried, hydrolyzed with 2% AcOH and separated on Biogel P6. Fractions were analyzed by NMR. Fractions that contained C. jejuni N-glycan signals were combined and separated on an anion-exchange Hitrap column using an NaCl gradient. Fractions were again analyzed by NMR. C. jejuni N-glycan LPS-core components eluted as a broad peak after the enterobacterial common antigen peak (data not shown). Fractions containing C. jejuni N-glycan signals were desalted by Sephadex G-15 chromatography. Connections were confirmed by NOE and HMBC.

Chicken challenge studies

Animal studies were carried out in accordance with the protocol approved by the Animal Care and Use Committee at the University of Alberta using a 35 day challenge protocol. In general each group contained up to 8 birds (SPF Leghorns, Poultry Research Facility, University of Alberta) that were randomly tested for the presence of C. jejuni on the day of hatch (day 1) by plating cloacal swabs onto selective Karmali agar. In all cases no C. jejuni colonies were observed on plates after 48 hr of incubation under microaerobic conditions at 37 °C.

Chicken vaccination

To test the efficacy of the protein glycoconjugates, birds received 300 μl of protein antigen prepared 1:1 in Freund's complete adjuvant for the 1 st vaccination (day 7) and the same amount but with Freund's incomplete adjuvant for the 2 nd vaccination (day 21). Antigens were injected at two sites in the chest with 150 μl of vaccine formulation per site or in the leg with 150 μl of vaccine formulation in each leg. Control groups received PBS in Freund's complete/incomplete instead of protein. Vaccination with whole cells of E. coli was done by orally gavaging 300 μl of PBS containing 1 × 10*8 live or inactivated (cross-linked, as described above) E. coli cells on days 7 and 21. Control groups were gavaged with 300 μl of PBS only. In the case of the E. coli whole cell live vaccine, cloacal swabs taken at various time points were plated onto LB Km-Cm. Relative CFUs for each bird were determined by colony counts after 18 hr of incubation at 37 °C.

Campylobacter challenge

Birds were orally gavaged (challenged) on day 28 with either PBS (negative control) or with 300 μl PBS containing 10*2 or 10*6 C. jejuni strain 81–176 cells. To prepare the challenge, C. jejuni 81–176 was grown for 18 h on MH agar and harvested with cold MH broth. Cells were washed twice with cold PBS and adjusted to an OD 600 of 1.0 (OD 600 of 1.0 equals 1.5 × 10*9 cell/ml). Serial dilutions in PBS were performed dependent on the final amount of cells that were administered. For example: 3 × 10*2 cells/ml (=1 × 10*2 cells per 300 μl =1 dose). Cells were maintained on ice until used. Birds were maintained for 7 days after challenge and then euthanized according to the approved guidelines of the Canadian Council for Animal Care. Ceca were collected, the contents were removed and weighed and adjusted to 1 mg cecal content per 1 ml with sterile PBS. Aliquots of 10-fold serial dilutions (in PBS) of the cecal contents were plated on selective Karmali agar. CFU were determined after incubation of the plates for 48 hr under microaerobic conditions.

Serum preparation

Blood samples were collected on day 7 (50 μl pre-bleed) and day 28 (100 μl vaccine response prior to challenge). Fresh blood samples were kept at room temperature for at least 18 hr or at 37 °C for at least 6–8 hr, until a firm blood clot was formed. Samples were centrifuged (5 min, 13, 000 × g, 4 °C) and the supernatant (serum) was transferred to a fresh tube. After addition of glycerol to a final concentration of 10%, the sera were stored at −20 °C until further use.

ELISA testing for N-glycan-specific antibodies

We developed a 96-well plate ELISA assay to quantify the N-glycan-specific IgY responses in vaccinated birds. fOS from C. jejuni (Cj) was prepared as described 74 and coupled to BSA by reductive amination as previously described 35 . Formation of the BSA-Cj-N-glycan conjugate was confirmed by Western blotting using R1-4 antiserum. After adjusting the concentration to 1 mg/ml using PBS, the glycoconjugate was stored at 4 °C until further use. We first tested the BSA-Cj-N-glycan conjugate binding capacity by coupling increasing amounts of the antigen and probed with R1-4 antiserum. A linear increase in signal intensity was observed over a range of 5 to 500 ng of the capture antigen (data not shown). No increase in signal intensity was observed when higher concentrations of the BSA-Cj-N-glycan conjugate were added to each well, therefore 500 ng of BSA-Cj-N-glycan conjugate per well were used for further analyses.

Then, 96-well Maxisorb plates (Thermo Fisher) were coated with 500 ng of BSA-Cj-N-glycan conjugate overnight (18 hr) at 4 °C. After removal of unbound antigen, the plate was blocked for 1 hr at RT with 5% skim milk in 100 μl PBS-T with shaking. After discarding the blocking solution, 100 μl of the antibody solution was added and incubated for 1 hr as described above. Antibody solutions were R1-4 antiserum diluted 1:3000 in PBS-T with 1% skim milk, or chicken serum (prepared from day 28 bleeds from the 2 nd vaccination experiment, Fig. 3B), diluted 1:10 in PBS-T with 1% skim milk. Plates were incubated for 1 hr at RT as described and each well was washed 3 times for 5 min with 100 μl of PBS-T. After addition of 100 μl of the secondary antibody solution (either anti-rabbit-AP (1:500), for the R1-4 control or anti-chicken IgY (1:500) for the experimental samples and incubated for 1 hr at RT), the secondary antibody solutions were discarded and the wells were washed 4 × 5 min with 100 μl of PBS-T. After the last washing step, the remaining washing solution was completely removed from each well and the plates were developed using pNPP as a substrate following the instructions of the manufacturer (Thermo Fisher). Immunoreactivity in each serum was determined after scanning the plate at OD 405 in a plate reader.

Chicken microbiome studies

Chicken microbiome studies were performed to analyze and compare the composition of the bacterial community in negative control (non-vaccinated, not challenged) and positive control (non-vaccinated, challenged) birds in comparison with birds that were challenged with C. jejuni after they received the E. coli live vaccine strain that expresses the N-glycan on its surface.

DNA isolation

First, 250–300 mg of cecal contents were placed in a 2 ml tube and washed with cold 1xSTE buffer (100 mM NaCl, 1 mM EDTA, 10 mM Tris/HCl pH 8.0). The sample was spun at low speed (1, 000 rpm) to remove large pieces of unwanted debris. The supernatant was placed in a new 2 ml tube and spun at a higher speed 14, 500 rpm on the mini-spin) to pellet the bacteria in the sample. The supernatant was removed; the pellet was resuspended by vortexing and was washed twice with 1 ml of ice cold 1xSTE buffer. After removing the supernatant, 180 μl of Qiagen ATL was added with 20 ml of Roche PK and digested overnight at 56 °C on a rotisserie. The DNA was extracted on the Biosprint using the Biosprint_96_DNA tissue and blood kit© according to the QIAGEN protocol. The DNA samples were quantified using the Promega QuantiFlour®dsDNA System kit.

Library preparation and quantification

Extracted DNA from chicken cecum samples was initially amplified using the universal primers 926F (5′-AAACTYAAAKGAATWGRCGG-3′) and 1392R (5′-ACGGGCGGTGWGTRC-3′) that targets the V6 to V8 region of the 16S ribosomal RNA gene with PCR conditions as detailed in the 16S Metagenomic Sequencing Library Preparation (Illumina®, San Diego, CA). A bioanalyzer trace of amplified products was obtained using the DNA 1000 chip on Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Amplicons with a single product at approximately 500 bp were determined to be suitable for further library preparation. Subsequently PCR cleanup was carried out using the Agentcourt Ampure XP beads (Beckman Coulter, Mississauga, ON). Nextera XT Dual indexing barcodes adapters (Illumina®) were attached to the bead-cleaned amplicons by a second PCR as detailed in the 16S Metagenomic Sequencing Library Preparation (Illumina®). Barcoded amplicons were cleaned up by an additional step of Agentcourt Ampure XP bead clean up (Beckman Coulter). ABI Veriti 96 well Thermal Cycler (Life Technologies, Burlington, ON) was used to run all the PCR reactions. Library quality was assessed by running the DNA1000 chip on the Agilent 2100 Bioanalyzer (Agilent Technologies). Library sizes ranged from 630 to 670 bp. Qubit HS dsDNA Assay (Life Technologies) was used to quantify the libraries. Individual libraries with their respective barcodes were pooled in a 4 nM library pool. The 16S rRNA gene sequencing was carried out on the Illumina MiSeq sequencer with the MiSeq Reagent kit V3 (Illumina) generating 300 bp reads in both the forward and reverse directions.

Microbiome - data analysis

Illumina 16S rRNA sequence reads were processed and analyzed as previously described 79 with minor modifications as follows. Reads were trimmed to 300 bp using FASTX-Toolkit (//hannonlab.cshl.edu/fastx_toolkit/) and paired-end reads were merged using the merge-illumina-pairs application (//github.com/merem/illumina-utils) with the following quality parameters: p-value = 0.03, enforce Q30 check, no ambiguous nucleotides and perfect matching to primers. An average of 227, 278 merged reads per sample was obtained. Files exceeding 150, 000 reads were subsampled to that amount of reads using Mothur v.1.32.0 to standardize the depth of analysis across samples, while all reads were kept for two samples in the dataset that had less than 150, 000 reads (84, 462 and 101, 732 reads). Merged sequences between 440 and 470 bp long were kept for analysis. USEARCH v.7.0.1001 was used to remove potential chimeras and to cluster the reads into operational taxonomic units (OTUs) using a 98% similarity cut-off. Taxonomic classification at the Phylum, Family and Genus level was assigned using the Ribosomal Database Project Multiclassifier v.1.1 tool. Taxonomic classification for the OTUs was done by selecting the highest percent identity for the OTUs representative sequences (selected by the UPARSE-OTU algorithm based on read abundance) when blasted against the Greengenes database, and confirmed through NCBI Blast and RDP SeqMatch. Percent proportions were calculated based on the total number of reads per sample. Diversity metrics were calculated using MacQIIME version 1.8.0. One-way analysis of variances (ANOVA) with Tukey's post hoc test was used to compare bacterial composition and differences in diversity between the treatments. Statistical analysis was performed using GraphPad Prism version 6.0 (GraphPad Software, La Joya, CA, USA).

Dodatne informacije

How to cite this article : Nothaft, H. et al . Engineering the Campylobacter jejuni N-glycan to create an effective chicken vaccine. Sci. Rep . 6, 26511; doi: 10.1038/srep26511 (2016).

Dodatne informacije

Word dokumenti

  1. 1.

    Dodatne informacije

Pripombe

Z oddajo komentarja se strinjate, da se boste držali naših pogojev in smernic skupnosti. Če se vam zdi nekaj zlorabe ali ne ustreza našim pogojem ali smernicam, označite to kot neprimerno.