Avtoimunska občutljivost, ki jo nalagajo javne verige tcrβ | znanstvena poročila

Avtoimunska občutljivost, ki jo nalagajo javne verige tcrβ | znanstvena poročila

Anonim

Predmeti

  • Avtoimunost
  • T-celični receptor

Izvleček

Čeprav je repertoar TCR zelo raznolik, manjši del verig TCR, ki jih imenujemo javne, prednostno oblikuje in jih večina ljudi deli. Predhodne študije so pokazale, da se javni TCRβ lahko prednostno uporabi v avtoimunosti. Hipotetizirali smo, da če ti TCRβ modulirajo verjetnost, da bo heterodimer TCRαβ produktivno vključil avtoantigen, ker so široko prisotni v populaciji in pogosto visoki frekvenci znotraj posameznih repertoarjev, bi lahko na široko vplivali tudi na odzivnost repertoarja na specifične avtoantigene. Tu ocenjujemo to z uporabo vrste javnega in zasebnega TCRβ, pridobljenega iz avtoimunskega encefalomielitisa, povezanega s TCR. Transgena ekspresija javnih, vendar ne zasebnih, povezanih z boleznijo TCRβ, združenih z endogeno preurejenim TCRa, je obdržala neopisane T celice z avtoantigensko reaktivnostjo. Dve od šestih javnih, vendar noben od petih zasebnih TCRβ ni sprožil spontane avtoimunosti na začetku miši. Naše ugotovitve kažejo, da en sam TCRβ zadostuje za podelitev reaktivnosti verig TCRαβ na avtoantigene, povezane z boleznimi, v okviru različnih TCRα. Nadalje predlagajo, da lahko javni TCR prekriva avtoimunsko dovzetnost in da lahko podskupi javnih TCR sekvenc služijo kot specifični za bolezni biomarkerje ali terapevtske tarče.

Uvod

Odpornost na T celice je odvisna od prepoznavanja T-celičnega receptorja (TCR) velikega števila antigenih peptidov, predstavljenih v kontekstu le nekaj glavnih proteinov kompleksnega histokompatibilnosti (MHC). MHC je polimorfen in vsebuje najmočnejši genetski dejavnik tveganja za avtoimunske in druge T-celično posredovane bolezni 1, 2, 3 . Le majhen del TCR repertoarja prepozna vsak posamezen kompleks peptid-MHC in ti TCR dopolnjujejo bolezen, povezano z MHC, da naložijo avtoimunsko tveganje. Somatska rekombinacija in kasnejše združevanje različnih TCR α in β verig dajejo T celicam s potencialno raznolikostjo 10 15–10 18 edinstvenih TCRαβ heterodimerov 4, 5 . Število krožijočih T celic je za nekaj vrst večje, zato bi moral biti TCR repertoar, ki je nameščen kot odgovor na določen bolezen, povezan antigen, v teoriji v veliki meri edinstven med posamezniki.

Kljub svoji teoretični raznolikosti se majhen del TCR α in β monomerov prednostno tvori zaradi rekombinatorialnih pristranskosti v zgodnjem razvoju T celic in jih večina posameznikov deli 6, 7, 8 . Ti TCR, imenovani javni, so bili povezani z različnimi imunskimi odzivi, vključno z avtoimunostjo 9, 10, 11 . Javni TCR α ali β verige par z neodvisno preurejenimi in večinoma nerezidanimi β ali α verigami tvorijo edinstvene TCRαβ heterodimere. Glede na to, da ligandna vezavna površina TCR α in β približno enakovredno prispevata k prepoznavanju peptid-MHC 12, javnih TCR, v katerih je deljena samo ena veriga TCR, ne bi bilo pričakovati, da bi pristransko prepoznali TCR. Pokazalo pa se je tudi, da so nekatere verige TRAV in TRBV prednostno uporabljene pri specifičnih imunskih odzivih. Na primer, TRBV-1 pogosto najdemo v sinovialnih T celicah pri bolnikih z reaktivnim artritisom, CDR3-zaporedje, pridobljeno z Vβ13.1, pa smo pogosto opazili pri klonih reaktivnih T-celic mielinskih osnovnih beljakovin pri bolnikih z multiplo sklerozo (MS) 13, 14 . V enem primeru je bil identificiran vezavni "vroči točka" med enim ligandom TRBV in antigen-MHC, kar kaže, kako lahko ena TCR veriga pristransko prepozna 9 . Glede na to lahko javne α ali β verige, ki so fiksirane za V, J in CDR3 zaporedja, lahko modulirajo verjetnost produktivnega zapletanja med heterodimerom TCRαβ in avtoantigenom. V podporo tej hipotezi je ena skupina poročala, da je velik del TCRaβ + CD8 T celic iz ženskih miši, transgenih za HY specifični TCRβ, prav tako prepoznal antigen HY 15 .

Ker se javne verige TCR delijo v celotni populaciji in so zaradi njihove preferencialne tvorbe pogosto prisotne pri visoki frekvenci 16, če predpostavljajo TCR za prepoznavanje specifičnih avtoantigenov, lahko širše vplivajo na avtoimunsko dovzetnost pri posameznikih, ki imajo tveganje, povezano z MHC. Naši prejšnji rezultati, ki so uporabljali sekvenciranje repertoarja TCRβ med mielinskim oligodendrocitnim glikoproteinom (MOG), ki je bil podvržen eksperimentalnemu avtoimunskemu encefalomielitisu (EAE), so pokazali, da je raznolik javni repertoar TCRβ prednostno razporejen glede na ne-delni ali zasebni, pred imunski repertoar 17 . Tu ocenjujemo prispevek posameznih javnih in zasebnih TCRβ sekvenc k avtoimunskemu odzivu med MOG 35-55- induciranim EAE. Opisujemo miši, ki transgenično izražajo 15 javnih ali zasebnih z boleznimi povezanih TCRβ, od katerih se vsaka pari z endogeno preurejenim TCRα. Javni, vendar ne zasebni TCRβ selektivno nalaga avtoimunsko tveganje, spodbuja reaktivnost avtoantigena in celo razvoj spontane fulminantne avtoimunosti. Naše ugotovitve kažejo, da lahko enotne verige TCR v veliki meri vplivajo na reaktivnost repertoarja in podpirajo hipotezo, da pristranskosti prepoznavnosti, ki jih nalaga javni TCR, prispevajo k avtoimunskim odzivom.

Rezultati

Spontana avtoimunost, ki jo posreduje javni TCRβ

Da bi razumeli sestavo in dinamiko avtoimunskega efektorskega in regulativnega repertoarja, smo predhodno izvedli nasičeno sekvenciranje vranic in celic CNS iz 12 miši z MOG 35-55- induciranim EAE in 5 zdravimi kontrolami, pri čemer smo analizirali> 18 × 10 6 CD4 + Foxp3 - (Tconv) in Foxp3 + (Treg) TRBV13-2 + TCRβ 6, 17, 18, 19, 20, 21 . TRBV13-2 je prevladujoči TCRβ v TOG-specifičnih T celicah 22 . Naši rezultati so pokazali prisotnost raznolikega javnega TCR repertoarja znotraj avtoimunskega odziva in da so bile T celice, ki nosijo javni TCR, prednostno razporejene glede na zasebni TCR iz predimunskega repertoarja 17 . To je predlagalo vlogo javnih sekvenc pri nagnjenju k repertoarju k avtooreaktivnosti. Da bi bolje opredelili vpliv javnih TCRβ, smo ustvarili retrovirusne transgene (retrogene) miši na ozadju TCRβ - / -, ki so prisilile izražanje javnih in zasebnih TCRβ zaporedij, prepoznanih s pomočjo teh zaporednih analiz in iz MOG 35-55 specifičnih T celičnih hibridomov ( Tabela 1). Miše, retrogene za ovalbuminsko specifično verigo OTIIβ, so bile ustvarjene kot avtoantigenska nespecifična kontrola.

Tabela polne velikosti

Najdeni so bili TCRβ1 v vranici in CNS Treg in Tconv pri vseh miših z EAE, ki so jih preučevali (tabela 1) 17 . Retrogeni miši TCRβ1 so se v 4 tednih enakomerno razvili spontano EAE, kar ustreza zelo zgodnji T celični vgradnji (slika 1A). Dejansko je bilo število celic T, ki so se infiltrirale v CNS v tem zgodnjem času, podobno številkam v vranici (slika 1B). Smrtnost je bila> 50% (slika 1A). Vdelali so celice CD4 + Foxp3 -, CD4 + Foxp3 + in CD8 + T, aktivacijski marker CD69 pa je bil v obolelih miših TCRβ1 povišan v vranici in CNS-celicah glede na retrogene miši OTIIβ (dodatna slika S1). TCRβ1 + T celice so se močno razmnožile kot odgovor na MOG 35-55 (slika 1C). Sleplenske celice in celice CNS iz retrogenih miši TCRβ1 so pokazale tudi diferenciacijo Th1 in Th17 podskupine, ki je povezana s patogenostjo v EAE (slika 1D in dopolnilna slika S1). Histološke analize osrednjega mišičnega tkiva TCRβ1 so pokazale mešan infiltrat limfocitov, makrofagov in granulocitov, gliozo in perivaskularno manšeto v septumu, meningih, očesnem živcu in belih poteh ledvene hrbtenjače v skladu z optično-spinalnim encefalomielitisom ( Sliki 1E in F, dopolnilna slika S1). Zlasti je bila bolezen pri retrogenskih miših TCRβ1 izrazito pospešena, povečana pojavnost in resnejša od naših predhodnih rezultatov z retrogenimi mišmi, ki so izrazile pet različnih zasebnih MOG-specifičnih TCRαβ heterodimerov 23 .

Image

TCRβ - / - Foxp3-GFP HPC smo transducirali s TCRβ1, da smo ustvarili retrogene miši. ( A ) Analiza Kaplana Meierja na splošno in brez bolezni. ( B ) Absolutno število CD4 + TCR + in CD4 + TCR + Foxp3-GFP + T celic v vranici in CNS miši TCRβ1 z EAE. ( C ) Razmnoževanje vranicnih T celic iz TCRβ1 ali nadzor retrogenih miši, ki izražajo verigo OTII TCRβ kot odgovor na MOG 35-55 ali mitogen, izmerjeno z vključitvijo 3 H-timidina. ( D ) Odstotek celic TCRβ1T, ki infiltrirajo CNS, ki izražajo IL-17, IFN-γ ali oba IL-17 in IFN-γ v odsotnosti ali prisotnosti ex vivo restimulacije, kot je določeno z obarvanjem znotrajceličnega citokina. ( E, F ) Histološke analize osrednjega mišičnega oživitve miši TCRβ1, ki kažejo mešan infiltrat limfocitov, makrofagov in granulocitov, glioze in perivaskularne manšete v septumu, meningih in očesnem živcu ( E ) ter belih poteh ledvenega dela hrbtenjače ( F ) na dan 28 TCRβ1, vendar ne in OTIIβ, retrogenih miši. ** p ≤ 0, 01; **** p ≤ 0, 0001.

Slika v polni velikosti

TCRβ1 vsiljuje specifičnost MOG na TCRaβ heterodimere

Hipotetizirali smo, da TCRβ1 podpira prepoznavanje MOG 35-55 s pomočjo TCR z različnimi TCRα. Za določitev zahtev po združevanju smo najprej izrazili TCRβ1 v hibridom CD4 + TCRαβ - 4G4 skupaj s 7 verigami TCRα, ki so bile izolirane iz ne-TCRβ1 TCR. Izražene so bile vse kombinacije α-TCRβ1, dva od sedmih hibridnih TCR pa sta se odzvala na MOG 35-55, kar kaže, da lahko TCRβ1 poganja odzivnost MOG 35-55 (sliki 2A in B). TCRα tvori z rekombinacijo endogenega lokusa pri razvijanju timocitov pri miših TCRβ1, zato bi lahko predvidevali, da je zelo raznolik. Za oceno raznolikosti TCRα, povezanega s TCRβ1 med avtoimunskim odzivom, smo iz 3 celic TCRβ1, ki jih infiltrirajo v CNS, izolirali cRNA TCRα iz 5 mišic s 5 'RACE. Ti so bili heterogeni in se niso prekrivali med miši (dodatna tabela S1), kar kaže, da je TCRβ1 povezan z različnimi TCRα.

Image

Sedem TCRα verig, pridobljenih iz ne-TCRβ1 TCR, smo klonirali v retrovirusni vektor MSCV-I-GFP s TCRβ1. Celice CD4 + 4G4 TCRαβ - hibridoma so bile transducirane in celice TCRαβ + razvrščene in stimulirane s 100 µg / ml MOG 35-55 ali anti-CD3. Proizvodnjo IL-2 smo merili z ELISA v 24 urah. ( A ) verige TCRα, ki so podeljevale odzivnost MOG 35-55, ko so združene s verigama TCRβ1 in ( B ) TCRα, ki nista podarili odzivnosti MOG 35-55 . Grafi so označeni z imenom TCRα (zgoraj), uporabo segmenta TRAV in TRAJ (sredina) in zaporedjem CDR3α (spodaj). ( C ) Pet verig TCRα, izoliranih iz CNS-infiltrirajočega TCRβ1 + TCR, je bilo povezano v TCRβ1 v retrovirusnih konstruktih kot zgoraj (TCRβ1-342α, TCRβ1-307α, TCRβ1-308α, TCRβ1-323α in TCRβ1-355α). Podobno so bile ustvarjene retrovirusne konstrukcije, ki vsebujejo šest zasebnih MOG 35-55 -reaktivnih TCRaβ (1MOG213, 1MOG203, 1MOG202, 5MOG113, 1MOG9 in 1MOG23). Konstrukcije smo pretvorili v CD4 + 4G4 TCRαβ - hibridomske celice in jih razvrstili glede na pozitivnost na GFP in podobne ravni TCR. Celične linije smo stimulirali z navedeno koncentracijo MOG 35-55 ali anti-CD3, proizvodnjo IL-2 pa smo 24 ur izmerili z ELISA. Zasebni (non-TCRβ1) TCR so prikazani na levi plošči, v desnem panelu pa TCRβ1 + TCR, ki infiltrira CNS. Zasebni TCR 1MOG9 je vključen v obe plošči, da ponazarja povečano občutljivost TCRβ1 + TCR v primerjavi s tistimi iz zasebnih MOG-reaktivnih TCR. Podatki so reprezentativni za vsaj 3 neodvisne poskuse, izvedene v dvojniku.

Slika v polni velikosti

Za količinsko določitev funkcionalne odzivnosti TCRβ1 + TCR v primerjavi z zasebnim TCR smo klonirali pet TCRα, pridobljenih iz CNS-infiltrirajočih TCRβ1 + T celic, skupaj s TCRβ1 v polikistronske retrovirusne konstrukte. Poleg tega je bilo podobno kloniranih šest TCRaβ iz zasebnih MOB 35-55- specifičnih T-celičnih hibriodomov. Sem spadata že opisana klona 1MOG9 in 5MOG113 23 . Vsi TCR konstrukti so bili transducirani v 4G4 CD4 + TCRαβ - T celični hibridom. Celice so bile razvrščene po so-eksprimirani GFP in podobni ravni TCR. Avidnost TCR in občutljivost na MOG smo funkcionalno določili s stimulacijo s titracijami MOG 35-55, pri čemer smo uporabili proizvodnjo IL-2 kot odčitek. Štirje od petih TCRβ1 izpeljanih TCR so pokazali povečano občutljivost za antigen za> 2–3 log10 in dramatično povečali največji odziv IL-2 glede na kateri koli zasebni TCR (slika 2C). To kaže, da TCRβ1 vsiljuje TCRαβ nenavadno visoko stopnjo odzivnosti na avtoantigen MOG 35-55 .

Da bi ugotovili, ali ne-transgene T celice ovirajo spontano EAE, ki ga posreduje TCRβ1, smo ustvarili himerne retrogene miši. Mešali smo divji tip (WT) CD45.1 + CD45.2 - in manjše število prirojenih TCRβ1-transduciranih CD45.1 - CD45.2 + hematopoetskih potomskih celic (HPC). Približno 40% miši je bilo zaščitenih pred spontano boleznijo. Ko se je razvil EAE, so bili simptomi blažji, umrljivost pa se je zmanjšala, kar je skladno z zaščitno vlogo za sočasno vključene WT celice (sliki 1A in 3A). Razmerje TCRβ1 in WT T celic je bilo izmerjeno v periferni krvi z zgodnjim vključevanjem (d28). TCRβ1 + celice so bile najpogosteje manjšine in bistveno manj pogoste pri miših, ki niso razvile EAE v primerjavi s tistimi, ki so se pojavile (slika 3B). Pričakovali smo, da bo TCRβ1 na zdravih živalih uvedel prepoznavanje MOG na neopisanih T celicah. Da bi to preizkusili, smo analizirali odzivnost MOG 35-55 pri nepoštenih himernih miših brez bolezni. T celice smo označili z vijolično celično sledovo in jih stimulirali bodisi z MOG 35-55 bodisi αCD3 / αCD28. TCRβ1 + CD45.2 +, vendar ne WT CD45.1 + T celice neopisanih miši brez bolezni, so se močno razmnožile do MOG 35-55 (sliki 3C in D). Približno 15, 6 ± 7, 8% začetne populacije celic CD45.2 + T se je odzvalo na MOG 35-55 v primerjavi z 49, 2 ± 12, 3% za nadzor αCD3 / CD28. Alternativne analize, ki so izmerile vključitev 3 H-timidina v sortirane in stimulirane celice CD45.1 + in CD45.2 + T, so dale podobne rezultate (slika 3E).

Image

( A ) Narisane so proste bolezni in splošno preživetje miši, ki je himerno za celice WT (CD45.1 + ) in TCRβ1 (CD45.2 + ). ( B ) Odvzeti vzorci periferne krvi so bili odstranjeni na dan 28. Odstotek CD4 + TCR + CD45.2 + (TCRβ1 + ) T celic med celotnimi celicami CD4 + TCR + T pri himernih miših, ki razvijajo ali ne razvijajo EAE. ( C ) Ex vivo proliferacijo CD4 + CD45.1 + (WT) in CD4 + CD45.2 + (TCRβ1 + ) T celic iz reprezentativne retrogene miške brez bolezni 8 tednov smo izmerili z redčenjem CellTrace Violet 72 ur po stimulaciji. Narisi prikazujejo skupno število celic (črna črta), podatke o številu celic, ki ustrezajo modelu širjenja (rdeča črta), in posamezne proliferativne generacije (modre črte). ( D ) Povzeti podatki iz T celic posameznih miši, stimulirani kot v ( C ). Za oceno števila starševskih celic, katerih potomstvo je poseljevalo posamezen vrh, je bila vrednost vsakega pika delitve deljena z 2 n, kjer je n = število vrhov delitve. ( E ) CD4 + TCR + CD45.2 + (TCRβ1 + ) in CD4 + TCR + CD45.1 + (WT) T celice so bile razvrščene iz 8-tedenskih himernih miši brez trenutnih ali zgodovinskih znakov EAE. Celice smo stimulirali, kot je navedeno, in proliferacijo izmerili 3. dan z vključitvijo 3 H-timidina. *** p ≤ 0, 001.

Slika v polni velikosti

Javni, vendar ne zasebni TCRβ podeljuje mielinsko specifičnost in izzove spontano avtoimunost

TCRβ1 je, kot vemo, prvi primer ene same verige TCR, ki daje heterogeno populacijo T celic z očitno spontano avtoaktivnostjo pri miših, ki sicer niso dovzetne za spontano avtoimuniteto. Da bi celoviteje opredelili vpliv javnih TCRβ, smo ustvarili 14 dodatnih TCRβ retrogenih miši (tabela 1). Tako kot TCRβ1 so bili tudi TCRβ2-6 identificirani pri ≥9 od 12 CNS 'in pri vseh vranicah miši z EAE, ki so bili analizirani (skupina 1; skupna uporaba CNS, javna) 17 . TCRβ7-10 so bili opaženi v enem samem CNS pri visoki frekvenci in si jih delili v splenocitih do različnih razsežnosti (skupina 2; CNS, ki ni skupna, javna). TCRβ11-15 so bili popolnoma zasebni (skupina 3; zasebni). Kot smo že poročali, velik del C-celic, ki infiltrirajo CNS v MOG-EAE, prepozna epitop MOG 35-55 17, 24 . Da bi zmanjšali možnost, da so TCR, izbrani za analizo, izhajali iz T nespecifičnih celic navideznega T, sta skupini 2 in 3 TCRβ izvirali iz visokofrekvenčnih infiltrirajočih klonov CNS (β7-11) ali iz TCRαβ zaporedij, izoliranih iz zasebnih T celičnih klonov prepoznamo avtogenov MOG 35-55 (β12-15). Za vsak TCRβ so retrogene miši spremljali klinično bolezen 120 dni ali do razvoja bolezni, v tem času pa so bili histološko pregledani vsi glavni organi. T-celice iz dodatnih miši, ki niso bile bolezni, so bile testirane na specifično odzivnost MOG 35-55 .

Med dodatno TCRβ skupine 1 ni noben razvil spontanega EAE (dopolnilna slika S2), čeprav sta 2 od 5 miši pokazala avtoimunske lastnosti. Nepopisane T celice miši TCRβ4 so se močno razmnožile kot odziv na MOG 35-55, izmerjeno tako s testami vgradnje 3 H-timidina kot z membrano, povezanimi z redčenjem barvil (slika 4A-C). Zato, tako kot TCRβ1, tudi TCRβ4 daje velik delež TCRαβ s specifičnostjo za avtoantigen MOG 35-55 . Celice TCRβ3T se niso odzvale na MOG 35-55 (dopolnilna slika S3). Vendar pa so z zgodnjim vsaditvijo te miši razvile spontano alopecijo in ezofagitis (slika 4D-F). To je bilo povezano z izrazitimi T-celičnimi infiltrati na teh lokacijah, kar kaže, da lahko ta TCRβ, povezan s CNS, izzove alternativne vrste spontane avtoimunosti.

Image

( A ) Razmnoževanje T celic iz neopisanih in brez bolezni retrogenih mišic TCRβ4 smo izmerili z redčenjem barvil 72 ur po stimulaciji, kot je navedeno. ( B ) Odstotek začetnih celic TCRβ4, ki se delijo kot odgovor na naveden dražljaj, je bil izračunan tako, da se vsak pik delitve deli z 2 n, kjer je n = delitveno število, da se oceni začetno število celic, ki tvorijo vsak vrh. ( C ) Proliferativni odziv očiščenih celic TCRβ4 T, izmerjen s pomočjo vključitve 3H-timidina. Krogi označujejo trikratnike posameznih miši. ( D ) Analiza Kaplana Meierja brez alopecije in skupnega preživetja pri retrogenih miših TCRβ3. ( E ) Hrbtna površina reprezentativne mišice TCRβ3 kaže na obsežne alopecijske površine. ( F ) Prezgodnji katagenski in vnetni infiltrati v folikularni in interfolikularni povrhnjici ter vnetni infiltrati, povezani z difuznim zgoščevanjem in hipercelularnostjo skvamoznega epitela ezofagela na dan 30 mišja TCRβ3. Imunohistokemija za CD3 + celice kaže izrazito povečano število celic T v primerjavi z zdravo kontrolno (CTRL) OTIIβ retrogene miške. ( G ) T celice iz retrogenih miši TCRβ7 smo izolirali in stimulirali, kot je navedeno. Proliferativni odziv smo izmerili pri 72 h s pomočjo vgradnje 3 H-timidina. Krogi označujejo trikratnike posameznih miši. **** p ≤ 0, 0001.

Slika v polni velikosti

Pri miših ni bilo histoloških ali kliničnih dokazov bolezni, ki bi izražale katerega koli od 4 skupin TCRβ iz 4 skupine, ki so bili identificirani v enem samem centralnem živčnem sistemu, vendar v vranici (dodatna slika S2). Vendar so T celice ene od teh, TCRβ7, razmnožile šibko do MOG 35-55 . To smo ugotovili s 3 H-timidinskim vgradnjo, vendar ne z manj občutljivim testom redčenja barvil (slika 4G). Miše, ki izražajo 5 zasebno skupino 3 TCRβ, niso pokazale spontane reaktivnosti mielina ali klinične ali histološke bolezni (dodatni sliki S2 in S3). Skupaj so tri javne TCRβ, dve v skupini 1 (TCRβ1, TCRβ4) in ena v skupini 2 (TCRβ7), obdržale neopisane T celice z odzivnostjo MOG 35-55 v kombinaciji z endogenim TCRα. Dve javni verigi TCRβ skupine 1 sta izzvali spontano avtoaktivnost (TCRβ1, TCRβ3). Pri prisilnem izražanju zasebnega (skupina 3) TCRβ ni bilo opaziti avtoimunskega fenotipa.

Diskusija

Predhodno smo pokazali, da je javni TCRβ prednostno vključen v repertoar, ki se infiltrira v CNS, med MOG 35-55- induciranim EAE 17 . Z oceno 15 različnih TCRβ in vivo dodatno določimo diferencialni vpliv javnih in zasebnih receptorskih verig, vpletenih v avtoimunski odziv. Tri javne, vendar nobene zasebne TCRβ niso mogle podeliti odprtega MOG 35-55 - reaktivnosti na neopisane T celice, ki izražajo endogeno preurejeni TCRα. Z okrepljenim izražanjem dveh od šestih TCRβ v skupni rabi CNS je pri mišjem sevu izzvenela spontana avtoimunost, ki sicer ne razvije spontane bolezni. To pomeni, da lahko javni TCRβ izkrivlja repertoarne odzive in spodbuja reaktivnost na določene avtoantigene.

Ena od hipotez za prednostno vključitev javnih sekvenc v avtoimunski repertoar je, da ta zaporedja predpostavljajo TCRαβ za samo reaktivnost. Druge repertoarne študije so odkrile tudi javne sekvence med avtoaktivnimi T celicami 11, 25, 26 . Da lahko javni TCR v splošnem podeljuje odzivnost na samo-antigene, kaže tudi naša ugotovitev, da je transgena ekspresija javnosti, veriga TCRβ3, povezana z EAE, privedla do razvoja spontane alopecije areata in ne EAE. Zato lahko en sam TCRβ spodbuja reaktivnost na avtoantigene, povezane z boleznijo, iz različnih tkiv. V zvezi s tem je treba opozoriti, da ima prej izolirani TRBV13-2 + TCRβ iz hibridoma, specifičnega za MOG 35-55, 1MOG244.2, dve verigi TCRα. Transgena ekspresija ene TCRaβ je privedla do MOG 35-55 reaktivnih T-celic. Drugi TCRαβ je prav tako izzval spontano alopecijo areata, kar je potencialno nakazovalo na širšo povezavo med CNS in reaktivnostjo kože 27 . Možno je tudi, da prednostna uporaba javnega TCR med EAE odraža splošno povečanje odzivnosti TCR na antigen. Čeprav se špekulira, je mogoče, da se je TCR sooblikoval z MHC, tako da je večja prepoznavnost primerna v javnih frekvencah, ki so najpogostejše. Vsak model je podprt z našo ugotovitvijo, da imajo TCR, ki uporabljajo javno beta verigo, TCRβ1, izrazito povečano občutljivost in največji odziv v primerjavi s kontrolnim zasebnim TCR. Tako lahko ta javna β veriga spodbuja prepoznavanje MOG 35-55 s podelitvijo TCR s posebno visoko funkcionalno avidnostjo do antigena.

Ugotovili smo, da sta 2 od 6 skupin 1 TCRβ (v skupni rabi CNS in javni) in skupaj 3 javni TCRβ na široko vsiljena specifičnost MOG na TCRαβ. MOG-odzivnost je bila še posebej izrazita pri miših, ki izražajo TCRβ1, kjer se je skoraj tretjina števila CD4 + T celic živali, ki niso odzivale bolezni, ki so se odzvale na αCD3, razmnoževalo kot odgovor na MOG 35-55. Za razliko od interakcij protitelo-antigen, ki se lahko zanesejo na eno verigo Ig, vmesnik TCR-MHC močno vključuje tako površine TCRα kot β. Implicitno TCRβ1 prevladuje v interakcijah, ki definirajo specifičnost med prepoznavanjem MOG 35-55 -IA b, in to spremljajo več splošnih interakcij s TCRα, ki preprosto ne motijo ​​in zagotavljajo potrebno dodatno energijo povezovanja za učinkovito stimulacijo T celic. Ni mogoče izključiti, da se TCRβ1 in druge javne verige TCRβ vežejo avtoantigene na nekonvencionalni način, ki zmanjšuje odvisnost od TCRα, potrebne pa bodo strukturne študije za boljše razrešitev fizične narave reaktivnosti, ki jih nalagajo ti zaporedji 28 . Če povzamemo, prikazujemo, da posamezne sekvence TCRβ spodbujajo prepoznavanje mielinskega antigena v neopisanih T celicah. V omejenem in vivo vzorčenju 15 transgenih verig TCRβ smo to lastnost selektivno opazili v javnem TCR, kar je lahko pojasnilo prednostne vključitve javnih receptorjev v avtoimunski odziv.

Metode

Miši

C57BL / 6 J (B6), B6.129P2- Tcrb tm1Mom / J (TCRβ - / - ), B6.SJL- Ptprc a Pep3 b / BoyJ (CD45.1) in B6.129P2- Rag1 tm1Mon / J (Rag1 - / - ) miši smo kupili v laboratoriju Jackson (Bar Harbor, ME). Miševe Foxp3-GFP na B6 ozadju smo dobili od dr. A. Rudenskega (NYU) 29 . Miške so bile vzrejene pod pogoji, ki ne vsebujejo specifičnih patogenov, vsi poskusi na živalih pa so bili izvedeni v skladu z eksperimentalnimi postopki, ki jih je odobril institucionalni odbor za nego in uporabo živali pri otroški raziskovalni bolnišnici St. Jude. Nega živali je bila zagotovljena v Združenju za ocenjevanje in akreditacijo laboratorijskih zavodov za nego živali (AAALAC), ki je akreditirano v prostorih za otroške pregrade pri otroški bolnišnici St. Jude.

Pretočna citometrija

Celice smo 20 minut obarvali pri 4 ° C v PBS, ki je vseboval 0, 1% natrijevega azida in 2% (vol / vol) fetalnega govejega seruma (FBS). Monoklonska protitelesa, specifična za CD4 (klon RM4-5), CD8 (klon 53-6.7), TCRβ (klon H57-597), CD69 (klon H1-2F3), CD45.1 (klon A20) in CD45.2 (klon 104 ) so bili kupljeni pri BD Biosciences. Intracelično obarvanje foxp3 (klon FJK-16s) smo izvedli z uporabo Foxp3 obarvajočega puferja (eBioscience). Za obarvanje citokinov celice gojimo 4 ure pri 37 ° C s celicnim stimulacijskim koktajlom (eBioscience) v prisotnosti 10 μg / ml monensina (eBioscience), čemur sledi fiksacija, permeabilizacija in obarvanje za IL-17A (klon eBio17B7, eBioscience) in IFN-γ (klon XMG1.2, BD Biosciences). Pretočna citometrična analiza je bila izvedena na LSRFortessa (BD Biosciences) in analizirana s programom FlowJo (Tree Star).

Molekularno subkloniranje

Segment TCRβ1 CDR3-Jβ je nastalo z žarjenjem par komplementarnih oligonukleotidov St Jude Hartwell centra sintetiziranih (5'-TCGAGTTGGCTACCCCCTCTCAGACATCAGTGTACTTCTGTGCCAGCGGTGAGACTGGGGGAAACTATGCTGAGCAGTTCTTCGGACCAGGGACACGACTCACCGTCCTAGAA-3 '; 5'-GATCTTCTAGGACGGTGAGTCGTGTCCCTGGTCCGAAGAACTGCTCAGCATAGTTTCCCCCAGTCTCACCGCTGGCACAGAAGTACACTGATGTCTGAGAGGGGGTAGCCAAC-3'). To je bilo subklonirano kot XhoI / BglII fragment v prej klonirano VC območje 1MOG244.2 TRBV13-2 TCRβ za sintetično ponovno ustvarjanje TCRβ1 23 . Tudi drugi TCRβ konstrukti so bili podobno zgrajeni. OTII TCRβ smo ojačali s PCR (5 '-GCCGAATTCGCCACCATGTCTAACACTGCCTTC-3'; 5 '-GTCACATTTCTCAGATCTTCTAG-3') in nato subklonirali v mesta EcoRI / BglII v MSCV-TCRβ1-GFP in zamenjali domeno TCCβ1-GFP in nadomeščali domene TCC-JRR TC1. Za polikistronske konstrukte TCRαβ smo TCRα in β verižne cDNA povezali, kot je opisano s pomočjo T. asigna 2 Zaporedje in vstavljeno v retrovirusni vektor MSCV-I-GFP, kar omogoča stehiometrično proizvodnjo vsakega proteina iz enega sporočila 30, 31 .

Generacija retrogenih miši

Retrogene miši so bile ustvarjene, kot je opisano prej 23, 30 . Na kratko so celice kostnega mozga iz mišic TCRβ - / - pobrali in gojili v celotnem Kličkovem mediju (Invitrogen), dopolnjenem z 20% FBS, 20 ng / ml mIL-3, 50 ng / ml hIL-6 in 50 ng / ml mSCF (Pepro Tech) 48 ur. Hematopoetske progenitorne celice (HPC) so sokultirali 48 ur z obsevanimi (1200 rad) retro + virusnimi celicami GP + E86 v celotnem Click-ovem mediju, dopolnjenem zgoraj, in s 6 μg / ml polibrena. HPC so pobrali in vbrizgali iv v subletalno obsevane (450 rad) prejemnike Rag1 - / - . Kopiranje analiziramo v periferno kri s pretočno citometrijo 28. dan po presaditvi HPC.

Klinično vrednotenje

Kohorte retrogenih miši so klinično spremljali ≥120 dni. Miše smo predložili na histopatološki pregled bodisi med končno boleznijo bodisi po 120 dneh, če so zdravi. Na vsaj treh miših za vsako skupino so opravili popolno nekropsijo, vključno s tkivi CNS. V vzorce tkiva, vdelanih v parafin, smo obarvali s hematoksilinom in eozinom (H&E) in po potrebi s CD3. Resnost spontanega EAE je bila določena z uporabo vnaprej določenih kvalitativnih in polkvantitativnih meril: 0, odsotnosti lezij, 1; minimalne do blage neopazne lezije; 2, vidne lezije; 3, izrazite multifokalne lezije; 4, označene koalescirajoče lezije.

Himerične miši iz kostnega mozga

HPC-ji iz mišic CD45.1 - CD45.2 + TCRβ - / - so bili transducirani z retrovirusom TCRβ1, kot je opisano zgoraj. Retrogene HPC smo pobrali in razredčili s CD45.1 + CD45.2 - prirojenimi celicami kostnega mozga B6 in jih nato injicirali v obsevane (450 rad) CD45.1 + CD45.2 - Rag1 - / - miši. Kopiranje je bilo analizirano 28. dan po presaditvi. Incidenca bolezni je bila spremljana najmanj 60 dni.

Test celične proliferacije

Splenične CD4 + T celice iz retrogenih miši smo očistili z MACS ločevalnimi stolpci in anti-CD4 Ab (L3T4) obloženimi mikrobeličami (Miltenyi Biotec) in jih gojili s 5 × 10 4 na vdolbinico v 96-jamskih ploščah z 2 × 10 5 obsevani (3500 rad) singenični vranicni APC s 100 μg / ml peptida MOG 35-55 v času 72 ur. Celice smo pulzirali z 1 µCi 3 H-timidinom (PerkinElmer) in jih pobrali 16 ur kasneje. Miški T-aktivator CD3 / CD28 Dynabeads (Invitrogen) smo dodali, kjer je to navedeno v razmerju med kroglico in celico 1: 1. Alternativno so bile celice pred stimulacijo v skladu z navodili proizvajalca označene s 5 μM CellTrace Violet (Invitrogen). Celice smo obarvali s površinskimi markerji in z redčenjem barvil merili 7-AAD (BD Biosciences) in razmnoževanje T-celic. Analiza širjenja je bila izvedena s programsko opremo Flowjo.

Analiza citokinov

Kulturne supernatante iz primarnih T celic smo zbrali pri 48 urah in analizirali na IL-2, IL-4, IL-10, IFN-γ in IL-1α z uporabo mišjega kompleksa za imunološki test citokin / hemokin MAP Milliplex (Millipore) na Luminexu (Bio-Rad) instrument. Za hibridome smo supernatant ocenili 24 ur samo za IL-2. Za obarvanje znotrajceličnega citokina so celice gojili s koktelom za stimulacijo celic in 10 μg / ml monensina (eBioscience) 4 ure pri 37 ° C, čemur so sledili fiksacija, permeabilizacija in znotrajcelično obarvanje za IL-17A in IFN-γ.

TCRαβ odziv na MOG 35-55

TCRβ1 cDNA je bila povezana z navedenim TCRα, ločenim s sekvenco T2A v vektorju MSCV-I-GFP, in polikistronski konstrukt, transduciran v hibridomske celice TCRαβ - CD4 + 4G4 23 . TCRαβ + celice smo razvrstili in sokultivirali s 3 × 105 (3500 rad) obsevanimi sineneičnimi vranicnimi APC in navedenimi dražljaji 24 ur. Supernatant kulture smo analizirali na IL-2 s sendvič ELISA (BD PharMingen).

5'RACE

T celice smo izolirali iz centralnega osrednjega mišičnega tkiva TCRβ1 z oceno bolezni ≥3. RNA smo izolirali in 5 'RACE izvedli z uporabo 5' / 3 'RACE kompleta 2. generacije (Roche) po navodilih proizvajalca. Na kratko, cDNA polne verige je bila sintetizirana iz mRNA z uporabo specifičnega primerja 1 (5 '-GGAGTCAAAGTCGGTGAACAG-3'). Predloga mRNA se je razgradila, na 3 'koncu cDNA je bil dodan polyA in rezana cDNA je bila PCR amplificirana s pomočjo sidrnega osnovnega sloja oligo (dT) (5'-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3 ') in 5 posebnega gnezdilca '-CCTGAGACCGAGGATCTTTTAAC-3'). Druga reakcija PCR je bila izvedena s sidrnim temeljnim premazom PCR (5 '-GACCACGCGTATCGATGTCGAC-3') in gnezdečim specifičnim temeljnim premazom 3 (5 '-CAGGTTCTGGGTTTGGAT-3'). Izdelke PCR smo klonirali v TOPO TA vektor (Invitrogen), zaporedje in zaporedja identificirali z uporabo baze podatkov IMGT (//www.imgt.org).

Statistika

Srednje, SD in krivulje Kaplana Meierja smo izračunali v Excelu ali PRISM. Parcele prikazujejo povprečno vrednost ± 1SD. Za primerjavo katere koli dve skupini in ANOVA za tri ali več skupin smo uporabili dvotirne t-teste študentov. Pri večkratnih primerjavah je pomembnost prikazana samo za navedene skupine. P p 0, 05 je bil ocenjen kot statistično pomemben.

Dodatne informacije

Kako citirati ta članek : Zhao, Y. et al. Avtoimunska občutljivost javnih verig TCRβ. Sci. Rep. 6, 37543; doi: 10.1038 / srep37543 (2016).

Opomba založnika: Springer Nature ostaja nevtralen glede zahtev glede pristojnosti v objavljenih zemljevidih ​​in institucionalnih pripadnostih.

Dodatne informacije

Datoteke PDF

  1. 1.

    Dodatne informacije

Pripombe

Z oddajo komentarja se strinjate, da se boste držali naših pogojev in smernic skupnosti. Če se vam zdi nekaj zlorabe ali ne ustreza našim pogojem ali smernicam, označite to kot neprimerno.